Labshake search
Citations for Millipore Sigma :
1451 - 1500 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Physiology 2024Quote: ... or acetylated Tubulin (T7451, clone 6-11B-1; Sigma-Aldrich ) at 4° C ...
-
bioRxiv - Cell Biology 2024Quote: ... Then primary mouse monoclonal antibody 6-11B-1 (Millipore Sigma) diluted 1:50 followed by secondary rat-absorbed Alexa 568-conjugated donkey anti-mouse antibody (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... 6% v/v Triton X-100 (EMD Millipore #TX1568-1) added by pipetting for a final concentration of 1% TX-100 ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Valine only labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887) and 150 mg/L sodium 4-methyl-2-oxovalerate (Sigma K0629) ...
-
bioRxiv - Biochemistry 2022Quote: ... Dimethyl LV labeling for geminal pair determination used 150 mg/L 2-Keto-(3-methyl-13C)-butyric-4-13C,3-d acid sodium salt (Sigma 589063). Valine only labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887 ...
-
bioRxiv - Biochemistry 2022Quote: ... 13C-ILV labeling used 150 mg/L 2-Keto-3-(methyl-d3)-butyric acid-4-13C,3-d sodium salt (Sigma 691887) and 70 mg/L 2-Ketobutryic acid-4-13C,3,3,d2 sodium salt hydrate (Sigma 589276 ...
-
bioRxiv - Biochemistry 2021Quote: The competitive inhibition of human fumarase activity in the presence of 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910) was fluorometrically assessed using a coupled enzyme assay ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Plant Biology 2020Quote: ... 2-3-week-old plants were treated with 150µM DCMU (D2425-100G, Sigma), kept for 1 hour in the dark and then exposed to high light (HL ...
-
bioRxiv - Cell Biology 2020Quote: ... TRCN0000037282 (shRNA Trim39#2) and TRCN0000438509 (shRNA Trim39#3) were from Sigma-Aldrich. Lentiviral particles were produced as previously described (Iréna Lassot et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... and 2 mg/ml N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) (Sigma, 03450) in 50 mM HEPES were added on top of the hydrogels and incubated for 30 min at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% DMSO and 300 μM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (MBS; Sigma) dissolved in microtubule stabilization buffer specific for algae (MTB ...
-
bioRxiv - Neuroscience 2021Quote: ... MTT[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide] were acquired from Sigma (USA). Purified water was prepared with a Milli-Q purification system from Millipore (Milford ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mg/ml N-(3-Dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC) (Sigma-Aldrich, 03450) diluted in 50 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.75 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) was added to culture medium for 2 h ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mg/ml N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (Sigma, catalog number 03450) in 50 mM Hepes] followed by 10 min UV-light activation ...
-
bioRxiv - Biophysics 2020Quote: ... and 2 mg/ml N-(3-dimethylaminopropyl)-N′-ethylcarbodiimidehydrochloride (EDC, Sigma-Aldrich, 03450) in 50 mM 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 μL 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide (MTT) solution (Sigma) was added to each well according to manufacturer’s instructions and analysed in a spectrophotometer at 580 nm ...
-
bioRxiv - Immunology 2021Quote: ... mtDNA depletion was induced by 100 μM 2′,3′ dideoxycytidine (ddC, Sigma-Aldrich) in medium supplemented with uridine and sodium pyruvate ...
-
bioRxiv - Biophysics 2020Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, p# M5655, Sigma-Aldrich) was dissolved in Phosphate Buffer Solution (PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... the reagent 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich) was added to the cells and incubated for 4 hours at 37 °C (5 % CO2) ...
-
bioRxiv - Neuroscience 2022Quote: ... buffered with 3 mM N-2-hydroxyethylpiperazine-N’-ethanesulfonic acid (HEPES, Sigma Chemical) and pH adjusted to 7.65 at 15°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The MTT compound (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Sigma-Aldrich) was dissolved in RPMI 1640 without phenol red ...
-
bioRxiv - Molecular Biology 2022Quote: ... growth medium was supplemented with 100 μM of 2′,3′-dideoxycytidine (Sigma; D5782) or 50 ng/ml of ethidium bromide ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 2, Phosphatase Inhibitor Cocktail 3, Sigma-Aldrich), and then incubated for 1 hour on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... Phosphatase inhibitor cocktail 2 (#P5726) and cocktail 3 (P0044) were from Sigma-Aldrich. Glutathione Sepharose 4B (#17-0756-01 ...
-
bioRxiv - Neuroscience 2024Quote: ... P8340) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, P5726 and P0044). Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by incubation in a solution of 2/3 dichloromethane (DCM; Sigma-Aldrich), 1/3 MetOH ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H tetrazolium Bromide – MTT (Sigma-Aldrich), MitoTracker probe (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... fed every day and split every 2-3 days using Accutase (A6964, Sigma).
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Biochemistry 2023Quote: Rosetta-gami 2 competent cells (Novagen / Millipore-Sigma, USA; cat. no. 71350-3)
-
bioRxiv - Biochemistry 2023Quote: Rosetta-gami 2 competent cells (Novagen / Millipore-Sigma, USA; cat. no. 71350-3)
-
bioRxiv - Neuroscience 2024Quote: ... 3-month-old male and female mice were anesthetized with 2% avertin (Sigma) and positioned in a stereotaxic apparatus (David Kopf instruments) ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor Cocktails 2 and 3 were from Sigma Aldrich (St. Louis, MO). Mouse anti-Rac1 antibodies (#ARC03) ...
-
bioRxiv - Molecular Biology 2024Quote: ... phosphatase inhibitor cocktails 2 and 3 (100uL/10mL, Sigma Cat #P5726 and P0044)) and lysates were cleared by centrifugation at 17,000g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies], 2 µg/mL heparin [Sigma-Aldrich] ...
-
bioRxiv - Microbiology 2020Quote: ... 200 μL of freshly made 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 1 mg/mL; Sigma-Aldrich, St. Louis, MO) in serum-free ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.8 µg pCMV-VSV-G (lentiviral envelope plasmid) and 2 µg purified shRNA DNA with 12 µg (3:1) of X-tremeGENE transfection reagent (Sigma Aldrich, #6366244001). Following 72 hours of transfection ...
-
bioRxiv - Microbiology 2020Quote: ... or mock nucleofected in the presence of one of the following inhibitors (auto= autophagy inhibitor, 3-methyladenine, authophagy inhibitor-M9281, Sigma Aldrich; apo= apoptosis inhibitor ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were permeabilized for one hour in a solution of phosphate-buffered saline (PBS) containing 3% bovine serum albumin (BSA, Sigma; A4503). Sections were incubated with primary antibodies in a solution of 1.5 % BSA and 0.2 % Triton X-100 overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... the reporter cells were exposed to drugs or DMSO vehicle for one hour before the addition of 3 ng/mL IL-1a (Sigma, I3901), 400 ng/mL C1q (MyBioSource ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting DNA was pipetted along one side of a coverslip that had been placed on top of a 3-aminopropyltriethoxysilane (Sigma-Aldrich)-coated glass slide and allowed to enter by capillary action ...