Labshake search
Citations for Millipore Sigma :
1251 - 1300 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Cell nuclei were counterstained with 10 μM 4",6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma) in TBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were counter stained using 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA) and incubated for 15 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were fixed with 4’,6-diamidino-2-phenylindole (DAPI) mounting media (Sigma-Aldrich). Immunofluorescence-labeled cells were imaged using a fluorescence microscope Eclipse Ci (Nikon) ...
-
bioRxiv - Genetics 2024Quote: ... and the nuclei were labeled with 4′,6-diamidino-2-phenylindole (DAPI, Sigma‒Aldrich, D9542). Image capture was performed by a laser scanning confocal microscope (Olympus ...
-
bioRxiv - Neuroscience 2024Quote: ... Counterstaining was performed using the fluorescent nuclear dye 4′,6-diamidino-2-phenylindole (DAPI) (Sigma). In situ hybridization was performed on 60 μm vibratome sections using digoxigenin-labelled antisense probe for Rorα ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 µl of 2 ng/ml anti-NeuN antibody conjugated with Alexa 488 (MAB377X, Millipore) in DPBS was added into the nuclei suspension ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates coated with 1.2% poly (2-hydro-xyethylmethacrylate)/95% ethanol (Sigma-Aldrich) and allowed to grow for 5 days ...
-
bioRxiv - Neuroscience 2023Quote: ... all slides were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (D9542, 1100, Sigma Aldrich). Slides were then rinsed and coverslipped with Prolong Gold antifade reagent ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Cell nuclei were stained by 4’,6-diamidino-2-phenylindole (DAPI, catalog #6329; Sigma Aldrich). Sections were first washed once in PBS for 10 min ...
-
bioRxiv - Immunology 2023Quote: ... Dead cells were excluded through the use of 4’-6’-diamidine-2′-phenylindole (DAPI) (Sigma). Alive DAPI- CD19+RBD+ B cells were single-cell index sorted using a FACSAria II (BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were incubated with 4′,6-diamidino-2-phenylindole dihydrochloride (Sigma-Aldrich, Catalog No. D9542) for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by incubation in 300nM 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, Catalog# D9542) at room temperature for 10 mins ...
-
bioRxiv - Cancer Biology 2024Quote: ... the nuclei were stained with 4’-6’-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, MO, USA). Stained slides were scanned using a Mantra system (PerkinElmer ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The sections were counterstained with 0.3 μM 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). For transient inactivation experiment ...
-
bioRxiv - Immunology 2023Quote: ... one 32-plex and one 13-plex (Sigma, Burlington, Massachusetts, USA). The assay was run according to the manufacturer’s protocol ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal) (Sigma) at a final concentration of 100 μg/ml as indicators ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 6 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s incomplete adjuvant (Sigma-Aldrich) for the first boosting ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5 μM RA treatments on days 0 and 4 plus 10 nM BIO (6-Bromoindirubin-3’-oxime, Sigma) treatment on day 0 ...
-
bioRxiv - Microbiology 2022Quote: ... female 3–4-week-old BALB/c or C57BL/6 mice were injected intraperitoneally with 10mg azoxymethane (Sigma) per kg mouse weight ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 100 mg tablet of 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, Sigma A9941) was dissolved in 100 mL of citrate buffer (50 mM ...
-
bioRxiv - Neuroscience 2023Quote: Five-month-old C57BL/6 mice (13/group; 10 male and 3 female) were administered dexamethasone (D2915, Sigma; 5mg/kg per day ...
-
bioRxiv - Biochemistry 2023Quote: ... The column was eluted using 6 mL of Strep-start buffer supplemented with 3 mM d-Desthiobiotin (Sigma). The elution was diluted with 20 mL of ion-exchange buffer (25 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were stained with 1 μg/ml 4′,6-Diamidino-2-phenylindole dihydrochloride in distilled water (D8417; Sigma-Aldrich, St. Louis, MO, USA), cover-slipped ...
-
bioRxiv - Genomics 2022Quote: ... slides were incubated in 1% Kodak PhotoFlo at RT for 1 minute and counterstained with 0.5 mg/mL DAPI (4′,6-diamidino-2-phenylindole, Sigma-Aldrich, St. Louis, MO, USA) in antifade based on DABCO (1,4-diazabicyclo(2.2.2)-octane ...
-
bioRxiv - Physiology 2024Quote: ... Nuclear stains used in this study were 4’,6-diamidino-2-phenylindole (DAPI; final concentration 1 μg/ml Sigma-Aldrich, St. Louis, MO, USA). F-Actin was stained with Alexa Fluor 568 phalloidin (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... Unbound antibody was washed with PBS++ including 4’,6-diamidino-2-phenylindole for initialization (DAPI; 1:10 000, Sigma Aldrich, St. Louis, MS, USA). Where needed ...
-
bioRxiv - Molecular Biology 2020Quote: ... Four days after the intravenous injection of 106 iRBC into C57BL/6 mice pre-treated one day earlier with phenylhydrazine 97% (Sigma-Aldrich, 6.18µl/ml) 1 ml of fresh mouse blood was mixed with 10 ml of ookinete medium ...
-
bioRxiv - Neuroscience 2022Quote: One day before plating, 6-well MEA plates (Axion Biosystems, M384-tMEA-6W) were coated with poly-D-lysine (Millipore Sigma P6407-5MG) in borate buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated with 50 µL of a 2 mg/mL solution of (3-(4,5-dimethyl-thiazole-2-yl)-2,5-biphenyl tetrazolium (MTT, Sigma-Aldrich) in PBS for 4 h and then exposed to 100 µL dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were washed with PBS and 3-(4,5-dimethyl-2-thiazolyl)2,5-diphenyl-2-H-tetrazolium bromide (MTT, Sigma-Aldrich) solution (final concentration ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1% of photoinitiator (2-hydroxy-2-methylpropiophenone - Sigma) was immediately introduced by capillary action between the PDMS stamp and the glass coverslip ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Bioengineering 2022Quote: ... The PEG pre-polymer phase comprised 27.5% w/v 5kDa 4-arm PEG acrylate (Advanced BioChemicals) with 4% w/v lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma) in phosphate buffered saline (PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... The PEG pre-polymer phase comprised 27.5% w/v 5 kDa 4-arm PEG acrylate (Advanced BioChemicals) with 4% w/v lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma) in phosphate buffered saline (PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... LC separation was performed on an Ascentis Express phenyl-hexyl column (100 × 2.1 mm, 2.7 μm; Sigma-Aldrich) with solvent A (HPLC-grade water + 0.1% Formic acid ...
-
bioRxiv - Bioengineering 2024Quote: ... Hydrogels for stiffening experiments were swelled in phosphate-buffered saline (PBS; HyClone) with 2.2 mM lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP; Sigma-Aldrich) photoinitiator overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...