Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for Sheep Anti CMV Pentamer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with GFAP antibody (mouse anti-GFAP; 3670S; 1:1000; CST, Danvers, MA) and TH antibody (sheep anti-TH; 1:1000; AB1542; Millipore Sigma, Burlington, MA) together at 4°C for 18 hours followed by appropriate secondary antibodies (donkey anti-mouse IgG [H+L] ...
-
bioRxiv - Microbiology 2023Quote: ... were tested by culturing the necropsy samples on Columbia sheep blood agars (Biolab Inc., Hungary) and sheep blood agars supplemented with nicotinamide adenine dinucleotide (Sigma-Aldrich Co., USA) at the final concentration of 20 µg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Cells were stained with 0.25 μg/well of an AlexaFluor 488-conjugated anti-CMV-immediate-early antibody (clone 8B1.2; Sigma-Aldrich), and samples were used only if >75% infected and if the variance between samples was <15%.
-
bioRxiv - Neuroscience 2021Quote: ... blocked in TNB for 15 minutes before incubation with an HRP-conjugated sheep anti-FITC antibody (Sigma, catalog # 11426346910) diluted at 1/500 in TNB for 30 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... blocked in TNB for 15 minutes before incubation with an HRP-conjugated sheep anti-FITC antibody (Sigma, catalog #11426346910) diluted at 1/500 in TNB for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by incubation in either sheep anti-mouse or donkey anti-rabbit IgG-conjugated with horseradish peroxidase (HRP) (Millipore Sigma, GENA931, GENA934, 1:4,000) in TBST at room temperature for two hours ...
-
bioRxiv - Microbiology 2020Quote: The p3×FLAG-CMV-14 vector (Sigma-Aldrich Corporation, USA) and pCMV-Myc (Clontech Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CFP1 cDNA subcloned into p3xFLAG-CMV-7.1 (Sigma E4023) and point mutations generated using site-directed mutagenesis were transfected with Lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The U6-gRNA/CMV-eCas9-2a-tGFP vector (Sigma-Aldrich) containing the guide RNA targeting SNX1 (GGACAACACGGCATTGTCA ...
-
bioRxiv - Cancer Biology 2024Quote: Human IGF2BP2 was cloned into p3XFLAG-myc-CMV 26 (Sigma) and pLVX-E1Fα-IRES-mCherry-Puro (Takara Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Neo-CMV-tGFP TIAM1 shRNA plasmid (Sigma Aldrich, Cat # 07202334MN ...
-
bioRxiv - Cell Biology 2023Quote: ... The pLKO.1-puro-CMV-tGFP vector (SHC003; Sigma Aldrich) was employed to generate ARRDC5 knockdown ...
-
bioRxiv - Developmental Biology 2021Quote: ... then blocked in PBT plus 5% normal sheep serum (Sigma) for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... was diluted 1:400 in 2.5% sheep serum (Sigma-Aldrich). Incubations were done for at least 36h at 4° C shaking and after each incubation time ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were subsequently blocked using 5% sheep serum (Sigma-Aldrich) (r.t. ...
-
bioRxiv - Neuroscience 2020Quote: ... and then were blocked with 10% sheep serum (Sigma-Aldrich) in solution I containing 100 mM pH 7.5 Tris-Cl with 0.15 M NaCl at room temperature for 1 hr ...
-
bioRxiv - Biochemistry 2021Quote: ... affinity purified Cul2 or IgG from sheep serum (15131, Sigma) using BS3 crosslinker (S5799 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg/mL prolactin from sheep pituitary (Sigma; cat. #L6520), and 10 ng/mL epidermal growth factor from murine submaxillary gland (Sigma-Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... Immunofluorescence staining was performed using sheep anti-α-MSH antibody (diluted 1:1,000 in 0.1 M PB, ab5087, Millipore Sigma), and rabbit anti-AgRP antibody (diluted 1:1,000 in 0.1 M PB ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated at room temperature for 30 minutes with HRP-labeled sheep anti-FITC antibody (1/500 in TNB, Roche/Sigma). Following washes in TNT ...
-
bioRxiv - Neuroscience 2022Quote: ... we used donkey anti-goat Igg H&L (Alexa Fluor® 647) Preadsorbed (Ab150135, 1:50) and sheep anti-rabbit Cy3 (Sigma–Aldrich C2306, 1:100).
-
bioRxiv - Biochemistry 2021Quote: ... The resulting fragments were subsequently cloned into p3xFLAG-CMV-14 (Sigma) or pGEX-6P-1 (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were blocked in 2 % goat or donkey anti-serum in KPBS and 3 % BSA plus 0.1 % Triton X-100 and incubated with primary antibody (rabbit anti-c-Fos, 1:200, Cell Signaling, Danvers, MA, USA; sheep anti-αMSH, 1:1000, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for 1 h at room temperature or overnight at 4 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... After blocking for 90 min with 5% sheep serum (Sigma-Aldrich) at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... or sheep’s blood (Hemostat DSB100) supplemented with 1mM ATP (Sigma A6419). Meals were warmed to 45°C before being used in the assay ...
-
bioRxiv - Cell Biology 2021Quote: ... for sheep antibodies or 3% (w/w) BSA (Sigma-Aldrich, A3059) for other antibodies ...
-
bioRxiv - Biochemistry 2021Quote: ... affinity purified Ubxn7 antibodies or IgG from sheep serum (15131, Sigma);
-
bioRxiv - Biochemistry 2021Quote: ... coupled to antibodies against Ubxn7 or nonspecific sheep IgGs (15131, Sigma), with two rounds of 1 h incubation at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Digoxigenin polyclonal antibody (Sheep, SKU: 11333089001) was obtained from Sigma Aldrich and digoxigenin monoclonal antibody (Clone # 611621 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Larvae were blocked in 10% sheep serum in PBDT for 1 hour at room temperature and then incubated in mouse anti-alpha acetylated tubulin (Sigma-Aldrich Canada Ltd ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The 1% BSA in PBST was then used to dilute sheep anti-digoxygenin Fab-fragments conjugated to alkaline phosphatase (1:1000, Sigma-Aldrich) in which the tissues were incubated overnight at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... The specimens were incubated at room temperature for 1 h in blocking buffer (PBSTX with 10% normal sheep serum and 2% bovine serum albumin) and subsequently with the primary antibody (rabbit-anti-GABA, Sigma-Aldrich A2052 ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by primary antibody incubation in 10% sheep serum at 4°C for 3 days (Anti-SCN5A antibody produced in rabbit (Sigma SAB2107930) 1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... a blocking step of incubation with sheep serum for 1 hour was followed by immunostaining for N using a mouse monoclonal antibody (αN009 48) and detected using a sheep anti-mouse FITC conjugate (Sigma, UK). Phalloidin Alexa Fluor 568 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... were washed twice with 1 mL of buffer and sensitised with a 1/1000 dilution of rabbit anti-sheep red blood cell stroma antibody (Sigma; S1389). After a 30 °C / 30 minutes incubation ...
-
bioRxiv - Physiology 2023Quote: ... Collected adrenal sections were probed with antibodies for TLQP-21 (rabbit anti-TLQP-21, 1:100, 20) or Tyrosine Hydroxylase (sheep polyclonal TH, 1:100, Millipore Sigma) overnight at 4°C in a humidified chamber ...
-
bioRxiv - Neuroscience 2021Quote: ... brain sections were incubated for 30 minutes with a horse radish peroxidase (HRP)-conjugated sheep anti-DIG primary antibody (Sigma, catalog # 11207733910) diluted at 1/500 in Tris-NaCl blocking buffer (TNB ...
-
bioRxiv - Neuroscience 2022Quote: ... brain sections were incubated for 30 minutes with a horse radish peroxidase (HRP)-conjugated sheep anti-DIG primary antibody (Sigma, catalog #11207733910) diluted at 1/500 in Tris-NaCl blocking buffer (TNB ...
-
bioRxiv - Cell Biology 2022Quote: ... a custom pLKO.1-puro-CMV- TurboGFP was purchased from Sigma-Aldrich, expressing a shRNA previously shown as efficiently targeting the CDS of PFN1 (5’- CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTT-3’)79 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were inserted into p3×FLAG-CMV-10 vector (Sigma-Aldrich) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... transfection with the pLKO.1-Neo-CMV-tGFP vector (Sigma-Aldrich, USA) was used to label cells with GFP.
-
bioRxiv - Developmental Biology 2019Quote: ... containing L-15 medium and sheep serum (Sigma-Aldrich, 10% v/v) as blocking solution ...
-
bioRxiv - Biochemistry 2023Quote: ... and sheep secondary antibodies for immunoblotting and immunofluorescence were obtained from Sigma.
-
bioRxiv - Neuroscience 2023Quote: ... Females were fed sheep blood (Hemostat DSB100) supplemented with ATP (Sigma A6419) at a final concentration of 1 mM using a Glytube membrane feeder (58) ...
-
bioRxiv - Biochemistry 2024Quote: ... and sheep secondary antibodies for immunoblotting and immunofluorescence were obtained from Sigma.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... cells producing HCMV specific antigens were detected 24h post infection by immunoperoxidase staining using monoclonal antibodies directed against the UL123-coded 72 kDa immediate early antigen 1 (IEA1) (Mouse Anti CMV IEA, MAB8131, Millipore, Temecula, CA, USA) and 120h post-infection by immunoperoxidase staining using monoclonal antibodies directed against UL55-encoded late antigen gB (LA ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was then incubated for 1 h at room temperature with sheep anti-mouse horseradish peroxidase (HRP)-conjugated antibody (Catalogue no. GENA931, Millipore Sigma, MO, USA) diluted 1:10000 in Milk/PBST ...
-
bioRxiv - Biochemistry 2022Quote: ... or −3 human cDNA into a p3XFLAG-CMV-14 expression vector (Sigma, E7908). Then 3XFLAG-PRLs were cloned into pLenti-CMV-puro (Addgene 17452 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CRISPR-Cas9 with a GFP reporter (Sigma Cat# CMV-CAS9-2A-GFP), and flow sorted based on expression of GFP and BFP reporters and absence of CD81/Cd81 ...
-
bioRxiv - Molecular Biology 2020Quote: ... H1299 cells were transfected with the p3×FLAG-CMV 10 vector (Sigma-Aldrich) containing human full-length NRF3 or GFP ...