Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for Mouse IgG2a Isotype Control Antibody Biotin 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and Control-shRNA (Sigma Cat# SHC016) was generated by co-transfecting the lentiviral plasmids in HEK293T cells with VSV-G (the envelop expressing plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... positive control rifampicin (1 µM, Sigma) the PXR-specific inhibitor resveratrol (10 µM ...
-
bioRxiv - Immunology 2023Quote: ... Positive controls included SEB (Sigma-Aldrich), CEF (NIH HIV Reagent Program) ...
-
bioRxiv - Cancer Biology 2023Quote: ... control (GGATGTAAGTGGGAAAGTGGA) were purchased from Sigma. siRNA targeting HSPD1 (L-010600-00-0005 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or DMSO vehicle control (Sigma, D8418). Drug and media were replenished daily for the total experimental duration (48 hours) ...
-
bioRxiv - Plant Biology 2020Quote: ... two primary antibodies were used: anti-OsCenH3 rabbit antibody and anti-α-tubulin mouse antibody (T6199, Sigma-Aldrich, St. Louis, MO. USA) (Nagaki et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... The following antibodies were used for immunostaining: anti-CREST/anti-centromere antibodies (human, Antibodies Inc.; 1:100) anti-Tubulin (mouse monoclonal, Sigma; 1:5000). DNA was stained with 0.5 µg/ml DAPI (Serva ...
-
bioRxiv - Cell Biology 2021Quote: Immunoprecipitation was performed using SRF or MKL1 antibody or control rabbit IgG with Magnetic Protein A/G beads (Magna ChIP A/G kit, Millipore), as described previously (36) ...
-
bioRxiv - Cell Biology 2022Quote: Immunoprecipitation was performed using SRF or MKL1 antibody or control rabbit IgG with Magnetic Protein A/G beads (Magna ChIP A/G kit, Millipore), as described previously (Chatterjee et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... The lysates were immunoprecipitated with 2 μg of IgG (negative control) or Smad3 antibody in coimmunoprecipitation reagents (17-195, Millipore). Semi-quantitative and quantitative PCR were performed to amplify α-SMA or Col1A promoter regions containing SBE.
-
bioRxiv - Microbiology 2021Quote: ... Immunoprecipitation of Lsr2-FLAG (or as a negative control, untagged Lsr2) was performed as described previously (44) using the FLAG M2 antibody (Sigma).
-
ANGPTL8 R59W variant influences inflammation through modulating NF-κB pathway under TNFα stimulationbioRxiv - Biochemistry 2023Quote: ... GAPDH was used as internal control for protein loading and detected using anti-GAPDH antibody (ab2302; Millipore, Temecula, CA, USA).
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were then washed and incubated with H3K27me3 antibody (1:200 dilution, Cell signalling 36B11#9733, control with IgG rabbit Sigma) for 2h30 at 4 °C on a rotating wheel and then washed twice ...
-
bioRxiv - Developmental Biology 2023Quote: ... HSF5-N2 and control IgG antibodies were crosslinked to 50 µl of protein A-Dynabeads (Thermo-Fisher) by DMP (Sigma). The antibody-crosslinked beads were added to the testis extracts prepared above ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein extracts of puromycin pulsed and non-puromycin pulsed control cells were subject to immunoblot (as above) using anti-puromycin antibody (clone 12D10, 1:1000, Sigma).
-
bioRxiv - Cell Biology 2020Quote: ... 10 μg/ml d-biotin (Sigma-Aldrich, St Louis, USA), 20 ng/ml recombinant human epidermal growth factor (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Reagents used in this study were Biotin (Sigma-Aldrich, B4501), Rhosin (Calbiochem ...
-
bioRxiv - Biochemistry 2022Quote: ... For the reduction-cleavable reagent (Azo Biotin-azide, Sigma-Aldrich) ligated sample ...
-
bioRxiv - Microbiology 2019Quote: ... biotin incorporation was revealed using streptavidin conjugated to HRP (Sigma). Primary antibodies used in the western blots were the mouse clone 7D2 against TG2 (#ABIN1109303 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 μL of 5 mM biotin picolylazide (900912 Sigma-Aldrich) and 25 μL of click reaction mix (3 parts TBTA 5 mM TBTA in butanol:DMSO (4:1 ...
-
bioRxiv - Neuroscience 2021Quote: ... IB4-biotin conjugate (1:200, Sigma, St. Louis, MO, #L2140), rabbit anti-CGRP (1:2,000 ...
-
bioRxiv - Biochemistry 2021Quote: ... Then the cells were treated with 100 μM Biotin (Sigma) in 0.1% FBS DMEM with or without 1 ng/mL EGF for 12 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 μl of click reagent (Dibenzocyclooctyne biotin conjugate; Sigma #760749) diluted in PBS was added (5 μM final ...
-
bioRxiv - Genomics 2022Quote: ... 1% Triton X-100 and 1 mM Biotin (Sigma-Aldrich)
-
bioRxiv - Microbiology 2022Quote: ... After incubating with 100 μM biotin (Sigma-Aldrich, cat#B4639) at 37°C for 3 h ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were cultured in media containing 50 μM biotin (Sigma) for 24 h ...
-
bioRxiv - Plant Biology 2021Quote: ... digoxigenin-11-dUTP or biotin-16-dUTP (all Sigma-Aldrich) and FISH were performed according to Jenkins and Hasterok (2007 ...
-
bioRxiv - Neuroscience 2021Quote: ... WFA biotin conjugate was used (Sigma L1516, dilution 1:1000), followed by incubation with Streptavidin (Alexa Fluor™ 594 conjugate ...
-
bioRxiv - Neuroscience 2022Quote: ... Biotin-conjugated Cholera Toxin B subunit (CTB, Sigma-Aldrich, C9972) or AAVrg-CAG-GFP (Addgene viral prep 37825-AAVrg ...
-
bioRxiv - Systems Biology 2022Quote: ... and the mixture was incubated with biotin-agarose (Sigma, USA) overnight to capture the pupylation linked interacting proteins ...
-
bioRxiv - Cell Biology 2020Quote: ... while Biotin-Tfn was probed with Streptavidin-POD conjugate (Sigma). Color was developed using OPD solution (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: Elution sample buffer was prepared by dissolving free biotin (Sigma) to saturation in sample buffer (NuPAGE LDS sample buffer 4X ...
-
bioRxiv - Microbiology 2022Quote: ... Media was changed with DMEM + 200 µM biotin (Sigma-Aldrich) and cells were incubated for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and immunoblotted with anti-biotin ms (Sigma B7653, 1:2000) for detection of biotin labeling or stained with Coomassie for detection of total protein ...
-
bioRxiv - Neuroscience 2023Quote: ... biotin-conjugated Wisteria floribunda agglutinin (WFA; 1:200 Sigma-Aldrich) in 5% NDS and PBST for 48h at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... TAMRA or biotin PEG3 azide (Sigma-Aldrich, 760757 or 762024), tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA ...
-
bioRxiv - Cell Biology 2023Quote: ... was performed prior to biotin treatment (50 μM; Sigma-Aldrich) for the indicated exposure times ...
-
bioRxiv - Developmental Biology 2023Quote: ... TdT enzyme and Biotin-16-dUTP (Sigma #3333566001 and #11093070910) were used according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... and 1 % (v/v) DSPE-PEG (2000)-biotin (Sigma Aldrich). 30 µl of this solution was carefully aspirated and spread onto a Polyvinyl alcohol (PVA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 10 mM desthio-biotin (no probe condition; Sigma D1411) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with 400 µM biotin (Sigma Aldrich, B4501) for 90 min along with 10 nM concanamycin A ...
-
bioRxiv - Microbiology 2024Quote: ... followed by incubation with 5 mM biotin-hydrazide (Sigma, France) for 60 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.
-
bioRxiv - Molecular Biology 2020Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.
-
bioRxiv - Microbiology 2023Quote: ... The non-targeting control siRNAs (MISSION siRNA Universal Negative Control #1, SIC001) were purchased from Sigma Aldrich.
-
bioRxiv - Cancer Biology 2023Quote: ... either with 25 nM sipool control (MISSION® siRNA Universal Negative Control #1 and #2, Sigma Aldrich) or with 25 nM of sipool for LISR (Sigma Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Detection was via polyclonal goat secondary antibodies: an ATTO647N-conjugated anti-mouse antibody was purchased from Sigma Aldrich, while an AlexaFluor488 (AF488)-conjugated anti-rabbit antibody was purchased from Invitrogen.
-
bioRxiv - Biophysics 2019Quote: ... Following primary antibodies were used: mouse monoclonal anti-pan sodium channel antibody (panNav; Sigma Aldrich, cat. no. S8809) and mouse monoclonal anti-ankyrin G antibody (Santa Cruz ...
-
bioRxiv - Cell Biology 2019Quote: ... Monoclonal antibodies used include mouse anti-tubulin antibody (used for immunoblotting at 1:2500; Clone DM1A, Sigma-Aldrich) and concentrated mouse anti-Rho1 antibody (used for immunofluorescence at 1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... The antibody used in this study is a mouse monoclonal antibody directed against α-Tubulin (clone DM1A, Sigma), labelled or cleaved into its Fabs as described in the section above ...