Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 10000+ citations for Mouse IgG2a Isotype Control Antibody Biotin 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... primary antibodies were revealed using HRP-coupled secondary anti-mouse (Sigma) or anti-rabbit antibodies (Cell Signaling ...
-
bioRxiv - Developmental Biology 2024Quote: ... Per replicate 5mg of mouse-M2-anti-FLAG antibodies (F1804, Sigma) coupled to protein A/G beads were used for chromatin immunoprecipitation ...
-
bioRxiv - Genomics 2024Quote: ... Mouse anti-NeuN antibody (Merck Millipore, MAB377, Clone A60, RRID: AB_2298772) was added to the nuclei at a final dilution of 1:500 ...
-
bioRxiv - Microbiology 2024Quote: ... and mouse monoclonal antibody against β– actin (Sigma, St. Louis, MO) was used for western blotting at a dilution of 1:2,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... Tubulin was probed with anti-tubulin mouse monoclonal antibody (Sigma # T4026), 1:10,000 in blocking buffer ...
-
bioRxiv - Immunology 2024Quote: ... and mouse anti-β-actin antibody (Millipore Sigma, cat. A5316-100UL) as a loading control ...
-
bioRxiv - Cancer Biology 2024Quote: ... Anti-β-Actin antibody-Mouse monoclonal (Sigma-Aldrich, Cat# A1978, RRID:AB_476692) at 1:5,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... A mouse antibody to NeuN (MAB377, Millipore, 1:1000 in PBS) was applied overnight at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... mouse anti-β-actin monoclonal antibody (clone AC15) from Sigma (A5441), and mouse anti-p36/MAT1 monoclonal antibody from BD Biosciences (#610532).
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with mouse anti-FLAG antibodies (Sigma-Aldrich, F1804) diluted (1:2000 ...
-
bioRxiv - Biochemistry 2024Quote: ... FLAG tagged PFD5 was detected using anti-FLAG mouse antibody (Sigma) and cMyc using anti-c-Myc rabbit antibody clone 7E18 (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with mouse anti-FLAG M2 antibody (1:3000; Sigma-Aldrich), washed with TBST (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... Primary antibodies used were mouse anti-α- tubulin (T9026, Sigma-Aldrich) and rabbit anti-acetyl-alpha-tubulin (Lys40 ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-alpha tubulin (DM1A) monoclonal antibody (1:10,000, #T9026, Sigma), mouse anti-Actin monoclonal antibody (1:5,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... The primary antibodies (PV; 1:1000, Swant CS56; 1:100, Sigma-Aldrich; Biotin-WFA; 1:100, Sigma-Aldrich, Gephyrin; 1:200, Synaptic system) were incubated overnight at 4 °C ...
-
The key features of SARS-CoV-2 leader and NSP1 required for viral escape of NSP1-mediated repressionbioRxiv - Molecular Biology 2021Quote: ... The membrane was probed with the following primary antibodies: mouse anti-flag antibody 1:2000 (F1804 Sigma), mouse anti-beta-actin 1:5000 (A2228 Sigma).
-
bioRxiv - Biochemistry 2021Quote: ... incubated with the following primary antibodies overnight: mouse anti-FLAG M2 antibody (1:10,000; Sigma-Aldrich; F3165) for spike protein or RBD detection and mouse anti-beta tubulin antibody (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... conjugated with 5 μg of one of the following antibodies: mouse monoclonal antibody to Flag (Sigma, F1804) or rabbit polyclonal antibody to HA (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... The following antibodies were used as primary antibodies: mouse monoclonal anti-Flag (M2 clone, 1:5000; Sigma), mouse monoclonal anti-6xHis (1:2500 ...
-
bioRxiv - Neuroscience 2021Quote: ... the antibody produced identical patterns in the mouse retina whole mount as a different Cx43 antibody (Sigma, #C6219 ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain sections were incubated in primary antibody (mouse anti-TH antibody, 1:2000, cat#: MAB318, Sigma-Aldrich, St ...
-
bioRxiv - Immunology 2020Quote: ... Primary antibodies (rabbit anti-ASNS – HPA029318, Atlas Antibodies, mouse anti-β actin, Clone AC-15, Sigma Aldrich) were diluted in LI-COR blocking buffer and detected using goat anti-rabbit-AF680 and goat anti-mouse-AF790 secondary reagents (Molecular Probes) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Immunofluorescence were performed with the following antibodies: mouse anti-Flag monoclonal antibody (F1804, Sigma Aldrich, 1:500); rabbit anti-G3BP1 antibody (1F1 ...
-
bioRxiv - Molecular Biology 2021Quote: Immunoblotting was performed using the following antibodies: mouse anti-Flag monoclonal antibody (F1804, Sigma Aldrich, 1:2000); rabbit anti-SARS-CoV-2 N antibody (9103 ...
-
bioRxiv - Cell Biology 2022Quote: Rabbit polyclonal antibody and mouse monoclonal antibody against FLAG were purchased from Sigma-Aldrich (St. Louis, MO). Monoclonal anti-Myc antibody was purchased from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a 1:10000 secondary antibody solution was made by diluting polyclonal anti-mouse antibodies (Sigma Aldrich, A4416) in TBS-T ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies were mouse anti-collagen type I monoclonal antibody (Sigma-Aldrich, #C 2456, diluted 1:100), mouse anti-collagen type II monoclonal antibody (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Cell Biology 2023Quote: The following antibodies were used as primary antibodies: mouse anti-vinculin (1:400; clone hVIN-1, Sigma), rabbit anti-non-muscle myosin heavy chain II-A (NMIIA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were detected using commercially available antibodies: anti-Flag mouse Antibody M2 (1:1000, Sigma-Aldrich M8823) and rabbit anti 4R-tau Antibody (1:1000 ...
-
bioRxiv - Genomics 2024Quote: ... Samples were incubated with primary antibodies (mouse anti-acetyl-alpha tubulin antibody, clone 6-11B-1 [Millipore-Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... The primary antibodies used in this study were a mouse anti-acetylated tubulin antibody (Sigma-Aldrich #T7451) diluted at 1:200 and a goat anti-serotonin antibody (Immunostar #20080 ...
-
bioRxiv - Neuroscience 2024Quote: ... CC1 (rabbit polyclonal antibody, 1:500, Oasis Biofarm, OB-PRB070, mouse polyclonal antibody, 1:300, Millipore, OP80), ASPA (rat polyclonal antibody ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used: Mouse Anti-NeuN Antibody (Millipore, Burlington MA, MAB377, dilution 1:100), Polyclonal Rabbit Anti-Glial Fibrillary Acidic Protein (Dako ...
-
bioRxiv - Cancer Biology 2022Quote: ... or negative control shRNA (TRC2 pLKO.5-puro Non-Target shRNA Control Plasmid DNA, SHC216, Sigma) were transfected to 60-70% confluent 293T cells grown on 6-well plates (1156D98 ...
-
bioRxiv - Cell Biology 2019Quote: ... The control group was treated with Mission siRNA Universal Negative Control # 1 (Cat# SIC001, Sigma-Aldrich). Gene silencing was done based on a previously published protocol (26 ...
-
bioRxiv - Cancer Biology 2023Quote: ... For LISR KD either control (MISSION® siRNA Universal Negative Control #1 and #2, Sigma Aldrich) or siLISR (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... α tubulin was used as a loading control and the probing was done by using mouse monoclonal anti-α-tubulin (Sigma T5168). The secondary antibody used was goat anti-mouse (HRP ...
-
bioRxiv - Bioengineering 2023Quote: ... or IgG2a-HRP conjugated (Southern Biotechnology Associates) and TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...
-
bioRxiv - Immunology 2021Quote: ... or control shRNAs for GFP (Sigma) and luciferase (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... with standard nucleoside controls (Sigma Aldrich) or dZ (Biosynth Carbosynth) ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... or vehicle control (DMSO, Sigma, D8418), as previously described.
-
bioRxiv - Biochemistry 2021Quote: ... control non-TRE: 5’CCTGCGTAGTTCCATAAGGATAGC (Sigma).
-
bioRxiv - Neuroscience 2019Quote: ... or matched control IgG (Sigma-Aldrich). The beads were then washed with 0.5% NP-40 buffer ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Vehicle control treatments (DMSO, Sigma-Aldrich) wells were treated in an identical manner ...
-
bioRxiv - Microbiology 2020Quote: ... or unlabeled control (‘12C’; Sigma-Aldrich) at a concentration of 1,000 ppm (6.9 and 7.3 mM ...
-
bioRxiv - Microbiology 2022Quote: ... negative control (Sigma-Aldrich, 200 μM); BAX-inhibiting peptide V5 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... or control rat IgG (Sigma-Aldrich) were added to T and B cell co-cultures ...
-
bioRxiv - Cancer Biology 2022Quote: ... or negative control siRNA (SIC001, Sigma), was transfected into 60-70% confluent cells grown on 60 mm culture dish (1156F05 ...
-
bioRxiv - Cell Biology 2022Quote: ... si-scramble (universal negative control, Sigma, Cat#SIC001 ...
-
bioRxiv - Neuroscience 2022Quote: ... Control non-targeting shRNA (Sigma, SHC002), and shRNAs targeting Mmp24 and Pcdhαc2 were obtained from Sigma (Mmp24 shRNA ...