Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... glyceraldehyde-3-phosphate dehydrogenase (mouse monoclonal, 1:5000, G8795; Sigma-Aldrich), β-actin (mouse monoclonal ...
-
bioRxiv - Developmental Biology 2022Quote: ... a 3:1 mix was prepared with polyethylenimine (Sigma, cat. # 408727) and DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... A volume of 200 μl 1-bromo-3-chloropropane (Sigma Aldrich) was added and the mixture was incubated for 10 min at room temperature before centrifugation (10 min at 10.000 x g) ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.052 mM 3-isobutyl-1-methylxanthine (IBMX; Sigma-Aldrich, The Netherlands), 0.2 mM indomethacin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... at ratio of 1:3 by volume in olive oil (Sigma) or olive oil alone (control ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit IgG anti-GluR2/3 (Millipore, cat. 07-598, 1:200), and chicken IgY anti-GFP (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... in a 1:3 ratio (w/w) in DMEM (Sigma-Aldrich) without supplements ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit polyclonal anti-integrin beta 3 (1:500, Millipore, Cat# AB2984), rabbit polyclonal anti-integrin beta 4 (1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and solvent control [1% DMSO + 3% Kolliphor EL (Sigma-Aldrich, #C5135) + 96% PBS] was administered by intraperitoneal injection at 10 mg/kg/day for 4 weeks starting on the day of tumor initiation.
-
bioRxiv - Plant Biology 2024Quote: 1-bromo-3-chloropropane (Sigma-Aldrich, Saint Louis, MO, USA; B9673)
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and from days 3-5 with 5 μM IWR-1 (Sigma). From days 13-19 metabolic selection medium was used ...
-
bioRxiv - Cell Biology 2024Quote: ... rat anti-cytokeratin 19 mAb (clone: TROMA-3) (1:200) (Sigma-
-
bioRxiv - Bioengineering 2022Quote: ... 3 the cell culture media was replaced 1-2 hours before imaging with RPMI media (Sigma-Aldric R8755) supplemented with B27 ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately1-2 μL of endotoxin-free DNA (1-3 mg/ml) diluted in PBS/0.025% Fast Green (SIGMA) was injected into the lateral ventricles of the forebrain using heat-pulled glass micropipettes (Drummond) ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μM 1-[2-[[(Diphenylmethylene)imino]oxy]ethyl]-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid hydrochloride hydrochloride (NO711) (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2023Quote: ... and phosphatase inhibitors (prepared in-house according to Phosphatase inhibitor cocktail 1, 2 and 3 from Sigma-Aldrich)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pellet was resuspended and incubated for 30 min at 4 °C in buffer B (10 mM Tris pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% Glycerol, 1 mM DTT, Sigma cOmplete EDTA-free Protease Inhibitor Cocktail) ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Phase 3 (S3, 2 days): S3 medium + 50 ng/mL FGF7 + 1 μM retinoic acid (Sigma, Cat# R2625) + 0.25 μM SANT-1 (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... organoid sections were washed twice for 3 minutes each with 3% bovine serum albumin (BSA) (Millipore Sigma # A2153) dissolved in PBS ...
-
bioRxiv - Systems Biology 2020Quote: ... We changed medium 2 days later (Day -2) with addition of 3 μg/mL Doxycycline (Sigma D9891) to induce the NIL transcription factors ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 day old transgenic animals were anaesthetized on 2% agarose pads containing 2 mM levamisole (Sigma, L9756). DAF-28::GFP expression pattern was examined in at least 30 animals on day 3 of adulthood ...
-
bioRxiv - Cell Biology 2020Quote: ... or cellulose solution in N-hydroxysuccinimide (NHS; Aldrich; 100 mM) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma; 100 mM, 90 min, RT)44 ...
-
bioRxiv - Molecular Biology 2021Quote: ... MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide] dye solution (Sigma-Aldrich, USA) (5 mg MTT in 1 ml PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with phosphatase inhibitors complex 2 and 3 (Sigma Aldrich, P5726-1ML, P6044-1ML), DTT 10 mM and protease inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Sigma-Aldrich) and phosphatase inhibitor cocktails 2 and 3 (P5726 and P0044, Sigma-Aldrich). Protein concentration was measured with BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2021Quote: ... The coverslips were then immersed in 2% (v/v) (3-Aminopropyl)triethoxysilane (Sigma A3648) prepared in acetone for 2 minutes at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were split every 2-3 days with trypsin (Sigma, Saint Louis, Missouri, USA) to maintain a subconfluent monolayer.
-
bioRxiv - Cell Biology 2020Quote: ... Sigma-Aldrich) and phosphatase inhibitor cocktails 2 and 3 (P5726 and P0044, Sigma-Aldrich). Protein concentration was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... concentrated to 2 ml using an Amicon concentrator with a 3 kDa cutoff (Millipore), and applied into a Superdex 75 (16/600 ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with phosphatase inhibitors complex 2 and 3 (Sigma Aldrich, P5726-1ML, P6044-1ML), DTT 10 mM and protease inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... 2× M63 buffer was made by adding 3 g KH2PO4 (Sigma-Aldrich cat. P5655), 7 g K2HPO4 (Sigma-Aldrich cat ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were subcultured every 2-3 days using trypsin (Sigma, Saint Louis, Missouri, USA) to maintain a subconfluent cell layer.
-
bioRxiv - Biochemistry 2020Quote: Ebselen (2-Phenyl-1,2-benzisoselenazol-3(2H)-one) is commercially available from Sigma Aldrich.
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 1X protease inhibitor and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich), for 30 minutes ...