Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... and 3 μM CHIR99021 (Sigma, #SML1046). mESCs for methylation analysis were cultured in 2i+serum conditions as above ...
-
bioRxiv - Microbiology 2022Quote: ... concentrated (Amicon 3 K Sigma Aldrich) and loaded onto a Superdex 200 increase 10/300 GL column (GE healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... indole-3-pyruvic acid (Sigma, Spain) and indole-3-acetic acid (GoldBio ...
-
bioRxiv - Plant Biology 2022Quote: ... 3 mM spermidine (Sigma-Aldrich, USA), and 50 mM octopamine (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... Oxygen consumption rates were calculated and normalized for protein content by Novagen BSA assay (71285-3, Sigma-Aldrich). Results are shown as fold change with respect to CM baseline condition.
-
bioRxiv - Physiology 2023Quote: ... protein concentration was quantified by Novagen BSA assay (71285-3, Sigma-Aldrich).
-
bioRxiv - Pathology 2023Quote: ... 3 μM TSA (Sigma-Aldrich, T8552), and 0.75 mg/mL trypsin (Gibco™ 15400054) ...
-
bioRxiv - Biochemistry 2023Quote: ... phosphatase inhibitor cocktail 3 (Sigma- Aldrich) and complete protease inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... and 3 mM ATP (Sigma-Aldrich) was added for 1 h to selectively activate NLRP3 ...
-
bioRxiv - Cell Biology 2022Quote: ... Benzonase Nuclease HC (Millipore, 71205-3), Urea (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3% normal donkey serum (Sigma) diluted in 0.1% PBS-T ...
-
bioRxiv - Plant Biology 2023Quote: ... and pGEX-4T-3 vectors (Novagen) for expression in E ...
-
bioRxiv - Developmental Biology 2023Quote: ... Arp2/3 complex (Sigma-Aldrich MABT95), N-WASP (Thermo Fisher Scientific PA5-52198) ...
-
bioRxiv - Microbiology 2023Quote: ... BPS (Sigma CAS# 52746-49-3), cobalt chloride (Sigma CAS# 7791-13-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 mM Na2-ATP (Sigma-Aldrich), 0.2 mM Na-GTP (Sigma-Aldrich) ...
-
bioRxiv - Genetics 2023Quote: ... Doxycycline (3 ug/ml, Sigma Aldrich) was added to induce TetO gene expression ...
-
bioRxiv - Bioengineering 2023Quote: ... or 3% BSA (Sigma-Aldrich, USA). 100,000 PEO4 cells were seeded on top of each coating and incubated for 2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µM CHIR99021 (Sigma-Aldrich SML1046), 1 µM PD0325901 (Sigma-Aldrich PZ0162) ...
-
bioRxiv - Neuroscience 2024Quote: ... LY294002 (Sigma; Cat# L9908, 3 μM).
-
bioRxiv - Bioengineering 2024Quote: ... deionized water (Direct-Q 3 Millipore, Billerica ...
-
bioRxiv - Biophysics 2024Quote: ... x 3/32 in (Sigma-Aldrich) and Elbow Luer connector male (Thistle Scientific ...
-
bioRxiv - Plant Biology 2024Quote: A 3% Phloroglucinol (Sigma Aldrich, UK) - HCl solution (Weisner stain ...
-
bioRxiv - Molecular Biology 2024Quote: ... monothioglycerol (3 μL/mL, Sigma-Aldrich), BMP-4 (bone morphogenic protein 4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CHIR99021 (Sigma Aldrich, #SML1046, 3 µM), and Rspo3-Fc Fusion Protein Conditioned Medium (Immunoprecise ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM magnesium acetate (Sigma #63052), 0.1 mM EDTA (Invitrogen #AM9261) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x Benzonase (Millipore 70664-3). Protein was quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific 23225 ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µg/mL mitomycin C (Sigma) was added to induce the tailocin genes in the P ...
-
bioRxiv - Microbiology 2024Quote: ... dynasore (304448-55-3, EMD millipore), desatinib (BMS-354825 ...
-
bioRxiv - Plant Biology 2024Quote: ... PEG8000 (Sigma, Cat#25322-68-3) was added to the indicated final concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mM MgCl2 (Sigma-Aldrich, M2670), and 10 mM PIPES (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... indole-3-acetic acid (IAA)(Sigma) was added at a final concentration of 500 μM for the final 1 hour of the mitotic arrest treatment to induce the degradation of CENP-C-AID-eYFP ...
-
bioRxiv - Physiology 2024Quote: ... neostigmine (3 µM, Sigma Aldrich, USA), for 25 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM Na-pyruvate (Sigma, #P2256), 2 mM CaCl2.2H2O (Quality Biological ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM Na-pyruvate (Sigma, #P2256), 0.5 mM CaCl2.2H2O (Quality Biological ...
-
bioRxiv - Microbiology 2024Quote: ... 3 M Tris-HCl (Sigma Aldrich) at pH 8,8 was added to neutralize the acidic elution ...
-
bioRxiv - Biophysics 2024Quote: ... indole-3-acetic acid (IAA)(Sigma) was added at a final concentration of 500 μM for the final 12 hours of the mitotic arrest treatment to induce the degradation of CENP-N-eGFP-AID ...
-
bioRxiv - Microbiology 2024Quote: ... with 3% BSA (Sigma-Aldrich – A1906) in PBS for 20 min ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM KCl (Sigma-Aldrich, P405), and 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM KCl (Sigma-Aldrich, P405), and 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... 30°C (Sigma 3-16PK, Germany) to remove the non-soluble fraction of the nanocomposites ...
-
bioRxiv - Neuroscience 2024Quote: ... and .3% triton X (Sigma-Aldrich) in MilliQ water for 2 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... and phosphatase inhibitor cocktail 3 (Sigma)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µM GSK3- inhibitor (CHIR99021, Sigma), 1 µM MEK-inhibitor (PD0325901 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3% horse serum (Sigma-Aldrich) was used for blocking.
-
bioRxiv - Bioengineering 2024Quote: ... Solvent Green 3 (Sigma-Aldrich, #211982), and Solvent Yellow 7 (#S4016) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3% β-mercaptoethanol (Sigma-Aldrich, M6250), 10 min at 95°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Millipore Sigma)/3% Fish Gelatin (G7765, Sigma Aldrich) and incubated with primary antibodies at 4°C overnight ...