Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 10000+ citations for Recombinant Human CTLA4 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 0.5 U DNA recombinant Taq polymerase in buffer (pH= 8.0; Sigma, Germany), 1x PCR buffer (pH=8.7 ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1 ng/mL of recombinant basic fibroblast growth factor (Sigma-Aldrich). RAW 264.7 macrophages were cultured in complete media composed of high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM (1x ...
-
bioRxiv - Biochemistry 2021Quote: ... Bovine erythrocyte ubiquitin and recombinant hsNEDD8 were purchased from Sigma-Aldrich (U6253) and BostonBiochem (UL-812 ...
-
bioRxiv - Microbiology 2020Quote: ... A set of recombinant RT standards (EMD Millipore, Molsheim, France; catalog# 382129) ranging from 5.12e3 nU/mL to 5.12e9 nU/mL was used to estimate the nU/mL of reverse transcriptase activity in the FIV stock.
-
bioRxiv - Microbiology 2021Quote: ... Recombinant VEGF (V7259) and TGF-β1 (100-21) was purchased from Sigma and PeproTech ...
-
bioRxiv - Microbiology 2020Quote: ... The Red/ET recombinant enzyme was induced by L-arabinose (Sigma-Aldrich) and a temperature shift from 30°C to 37°C ...
-
Q-SNARE Syntaxin 7 confers actin-dependent rapidly replenishing synaptic vesicles upon high activitybioRxiv - Neuroscience 2020Quote: ... neurons were incubated with 10 nM recombinant TeNT–light chain (Sigma–Aldrich) for 16 h in a CO2 incubator ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μM CHIR99021 (Cayman) and 1,000 U/ml recombinant mouse LIF (Millipore)39 ...
-
bioRxiv - Biochemistry 2021Quote: ... and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, Millipore). 293T cells were cultured in DMEM supplemented with 10% FCS.
-
bioRxiv - Biochemistry 2021Quote: ... and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, Millipore). ESCs were cultured on plates which were pre-coated with 0.1% gelatin ...
-
bioRxiv - Genetics 2020Quote: ... 10 ng/μL recombinant fibroblast growth factor basic (βFGF; Sigma-Aldrich, #F0291), 10 μg/μL Heparin (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: Recombinant hACE2 with a C-terminal deca-histidine tag (SAE0064, Sigma-Aldrich) was resuspended in PBS to a final concentration of 50 ng/μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were digested overnight at 37 °C with recombinant trypsin (Trypzean, Sigma) (enzyme ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant Wnt5A (Cat no.- 10UG 645-WN-010 R & D, GF146 Millipore) and recombinant Wnt3A (Cat no.- 10UG 5036-WN-010 R & D ...
-
bioRxiv - Cancer Biology 2022Quote: ... eluted in water and aliquoted for later use with recombinant Cas9 (Sigma). Oligos used for sgRNA production are listed in Extended Data Table 4.
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... media supplemented with 1000U/mL ESGRO Recombinant Mouse LIF (Millipore Sigma, ESG1107), 2 mM GlutaMAX (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... Serial dilutions from 2μg to 0.0625μg of recombinant SPARC (SRP3159, Sigma-Aldrich; S5174-25UG ...
-
bioRxiv - Molecular Biology 2023Quote: ... and with recombinant mouse Leukemia Inhibitory Factor (LIF, 20 U/ml, Millipore).
-
bioRxiv - Developmental Biology 2023Quote: ... and 10 μg/μl recombinant mouse leukemia inhibitory factor (LIF; Sigma-Aldrich) in a 5% CO2 incubator at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... interleukin 1b (recombinant murine Il-1b, Sigma-Aldrich, #I5271, 10 ng/mL) and interferone γ (recombinant mouse INFγ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The DNA was digested by adding 10 U DNase I recombinant (Sigma) and incubating for one additional hour ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-amyloid precursor protein (APP; mouse anti-human monoclonal antibody clone 22c11, dilution 1:10, epitope retrieval time 10 min, MAB348; EMD Millipore, Burlington, MA, USA); anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Microbiology 2021Quote: ... sBHI media controls or Porphyromonas cell-free supernatants (240 µg of total protein) were incubated with 120 µg of human fibrinogen (Sigma-Aldrich, St. Louis, MO). Reaction mixtures were incubated at 37°C under anaerobic conditions or in an atmosphere of 5% CO2 for cell suspension or cell-free supernatants ...
-
bioRxiv - Microbiology 2021Quote: ... with prior 1h incubation of the biotinylated oligonucleotide with the anti-G4 antibody BG4 (Merck Millipore).
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Cancer Biology 2020Quote: ... biotinylated cells were collected by scraping in PBS containing 100 µM oxidized glutathione (G4376, Sigma-Aldrich) to prevent the reduction of the disulfide bridge in the labeling molecule ...
-
bioRxiv - Neuroscience 2020Quote: ... the cells were incubated with biotinylated goat anti-mouse IgG (Sigma, St. Louis, MO, 1:500) as the secondary antibody for an hour ...
-
bioRxiv - Biophysics 2022Quote: ... The flow channel was incubated with 0.02 mg/mL biotinylated bovine serum albumin (BSA) (Sigma Aldrich) solution for 5 min and washed by BRB80 ...
-
bioRxiv - Immunology 2021Quote: ... 100 μl of diluted serum samples were added followed by biotinylated anti-mouse IgG (Sigma-Aldrich), IgG1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and subsequently pre-loaded with 2 μl biotinylated anti-FLAG antibody (BioM2, Sigma, cat. No. F9291). This was done in 500 μl wash buffer and the mixture was incubated for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... GM1 on the cells was stained by applying biotinylated cholera toxin subunit B (CTXB; Sigma‒Aldrich) and then FITC-labeled avidin (Zymed).
-
bioRxiv - Microbiology 2020Quote: ... Blotting was performed using a mouse monoclonal anti-6x His antibody (1:1000; Millipore HIS.H8) and a goat anti-mouse IgG HRP conjugated secondary antibody (1:2000) ...
-
bioRxiv - Microbiology 2020Quote: ... anti-mouse (BioSupplies) or anti-His (CBM) secondary antibodies conjugated to alkaline phosphatase (Sigma Aldrich) as described in Pedersen et al35 ...
-
bioRxiv - Bioengineering 2019Quote: Ni-NTA columns were prepared by packing 1 mL Ni-NTA His•Bind resins (Sigma) into a 6-ml ISOLUTE® Single Fritted Reservoir column with 10 μm polyethylene frit (Biotage ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-tag was cleaved by overnight incubation with thrombin (from bovine plasma, Sigma Aldrich) at 4 °C during dialysis ...
-
bioRxiv - Biochemistry 2020Quote: ... His-PBP1B containing fractions were pooled and treated with 2 U/mL of thrombin (Novagen) for 20 h at 4 °C during dialysis against dialysis buffer I (25 mM Tris-HCl ...
-
bioRxiv - Immunology 2022Quote: ... and 100 µL of alkaline phosphatase-conjugated anti-HIS tag antibody (Sigma-Aldrich, cat: A5588), diluted 1:2,000 in TBST ...
-
bioRxiv - Biochemistry 2021Quote: ... DTT was added to a final concentration of 0.5 mM and His-SUMO protease (Sigma) was added to a concentration 100-fold lower than the total protein concentration ...
-
bioRxiv - Bioengineering 2021Quote: ... then probed with the conjugated anti-6x His tag® mouse monoclonal antibody (Sigma-Aldrich) overnight at 4ºC or 1 hour at room temperature and rewashed three times with washing buffer (CMT ...
-
bioRxiv - Physiology 2020Quote: ... the N-terminal-His-tag was labeled with the Ni-NTA Atto550 fluorophore (Sigma-Aldrich) following the protocol provided by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... supernatants were subjected to purification using either HIS-Select HF Nickel Affinity Gel (Sigma-Aldrich) or Glutatione Sepharose 4B (GE healthcare) ...
-
bioRxiv - Plant Biology 2020Quote: ... and purified with a commercial kit according to manufacturer’s instructions (His-bind buffer kit, Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... and a western blot was performed using anti-HIS (Sigma H-1029, mouse, 1:3000) and anti-HA (Biolegend MMS-101R or ...
-
bioRxiv - Cell Biology 2024Quote: ... containing HI-2 at final concentration of 100 µM (or vehicle control DMSO, Sigma-Aldrich) was added to the cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... His-OGT-Flag was generated by subcloning the OGT cDNA into pET30a+ vector (Novagen®). siRNA-resistant human FOXK1 and FOXK2 cDNAs were synthesized into a pBluescript plasmid (Biobasic® ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysate was then incubated with HIS-select HF Nickel Affinity Gel (Millipore-Sigma) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysate was then incubated with HIS-select HF Nickel Affinity Gel (Millipore-Sigma) overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... and His-AC elution buffer were supplemented with 0.1 v/v% Tween-20 (Sigma Aldrich), 0.1 v/v% NP-40 (Thermo Fischer Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: Strep-Full-length REC114 and His-MEI41-127 were co-expressed from pRSFDuet-1 (Novagen) and pProEXHTb (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... For super-shift assays monoclonal 0.2 μl of Anti-His antibody (H1029, Sigma-Aldrich, USA) was used ...