Labshake search
Citations for Millipore Sigma :
1251 - 1300 of 10000+ citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... followed immediately by an equal volume of a freshly-prepared 5 mg/mL solution of 4-hydroxy-α-cyano-cinnamic acid (Sigma) in 50% aqueous (v:v ...
-
bioRxiv - Microbiology 2020Quote: ... HB10Y samples were titered prior to freezing by serially diluting samples in 10 millimolar (mM) of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Sigma PN#H4034-100G) + 10% Sucrose (Sigma PN #S7903-250G) ...
-
bioRxiv - Microbiology 2022Quote: ... HB10Y samples were titered prior to freezing by serially diluting samples in 10 millimolar (mM) of 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES, Sigma PN#H4034-100G) + 10% Sucrose (Sigma PN #S7903-250G) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Biophysics 2024Quote: ... 4% (3-Aminopropyl) triethoxysilane (APTES) (Sigma-Aldrich)-treated and 2% glutaraldehyde (Sigma-Aldrich)-activated 35mm glass-bottom dishes (Ibidi ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and blocked for 1-hr with 3% Normal Bovine serum in TBS containing 3% triton-X-100 (TBST, CAS-9002-93-1, Sigma, USA). Following blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... (1) A modification solution was made by dissolving 10 mM of 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC, Sigma-Aldrich Inc.) and 75 mM of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with 1 μM 4-hydroxy-tamoxifen (4-OHT; Sigma-Aldrich) and 1 μM Shield1 (Clontech lab ...
-
bioRxiv - Genomics 2021Quote: ... cells were first washed once with phosphate-buffered saline (PBS) and supplemented with equilibrated (37 °C and 5% CO2) medium containing 500 μM indole-3-acetic acid (Sigma-Aldrich, I5148) freshly prepared before use ...
-
bioRxiv - Bioengineering 2022Quote: ... cell-seeded wells (n=3 per group) were rinsed with PBS and incubated in 500 μL of 5% trichloroacetic acid (TCA, Sigma-Aldrich, T6399) in UPW for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... 4-day old Col_0 seedlings were incubated with LRC liquid medium supplemented with indicated concentrations of compounds (Adenosine 5′-triphosphate magnesium salt, ATP-Mg [VWR]; Abscisic acid, ABA [Sigma-Aldrich]; Carbonyl cyanide 3-chlorophenylhydrazone, CCCP [Sigma-Aldrich] ...
-
bioRxiv - Neuroscience 2020Quote: CSF samples were prepared for NMR by adding 16 µL 3-(Trimethylsilyl)-1-propanesulfonic acid-d6 sodium salt (DSS-D6; Chenomix/Sigma-Aldrich, Oakville, ON, Canada) to 30 µL CSF (pooled from 1 – 3 animals ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μM 5-fluoro-2’-deoxyuridine (Sigma Aldrich 200-072-5), penicillin ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were dissolved in 1 ml acetone/water (1:1, Carl Roth, Karlsruhe, Germany) and 0.1 % trifluoroacetic acid (Sigma Aldrich, Dreieich, Germany). 170-200 µL DHB matrix solution was applied to the sections using a pneumatic sprayer system with a nitrogen pressure of 0.7-0.75 bar ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Mice were administered (poly [4-styrenesulfonic acid-co-maleic acid] (PSCMA) (Sigma Aldrich, St. Louis, MO) (∼480 mg/kg body weight/day ...
-
bioRxiv - Cell Biology 2020Quote: ... at 1:1000 dilution and monoclonal antibody B-5-1-2 (Sigma) at 1:1000 dilution to detect α-tubulin as loading control.
-
bioRxiv - Genetics 2020Quote: 1-5×106 cells were fixed in 1 ml TRI-reagent (Sigma), snap frozen and stored at −80°C for less than one year ...
-
bioRxiv - Biochemistry 2021Quote: ... α-TUBULIN (ms, clone B-5- 1-2, Sigma T9026, 1:5000), rabbit IgG (gt ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Plant Biology 2024Quote: ... anti-microtubule antibody (1:2,000; clone B-5-1-2; Sigma- Aldrich), and ECL anti-mouse IgG horseradish peroxidase-linked whole antibody (1:1,000 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1% sucrose and 100μM 5-Azacytidine (Sigma). All plates were put in a growth chamber with long-day photoperiod (16h and 22°C light ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µM 5-fluoro-2’-deoxyuridine (Sigma), penicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µl (5 mg/ml) muscimol (Sigma) was injected into PR at 0.5 µl/min using G33 needle (Hamilton ...
-
bioRxiv - Immunology 2020Quote: ... 1 μl 5 M betaine (Sigma-Aldrich), 0.03 μl 1 M MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2021Quote: ... and 5 μg ml-1 insulin (Sigma). Microglia media was supplemented with 100 ng ml-1 IL-34 (Proteintech) ...
-
bioRxiv - Cell Biology 2021Quote: ... alpha-tubulin (B-5-1-2, Sigma), tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Tau-5 (Sigma-Aldrich; WB: 1:1,000), AT180 (pT231 ...
-
bioRxiv - Biophysics 2020Quote: ... 5 g L−1 Phytagel (Sigma-Aldrich), and cold vernalized for 48 h at 4°C in the dark ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI (Sigma-Aldrich, 1/10000, 5 min) was used for nuclear labeling and phaloidin488 (life technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI (Sigma-Aldrich, 1/10000, 5 min) was used for nuclear labeling and Isolectin B4 488 (life technologies ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μg mL-1 chloramphenicol (Cm, Sigma), and 15 μg mL-1 gentamycin (Gm ...
-
bioRxiv - Cancer Biology 2023Quote: ... + 5 IU·mL-1 Deoxyribonuclease I (Sigma-Aldrich) + 0.1% RNasin Plus RNase Inhibitor (Promega ...
-
bioRxiv - Bioengineering 2023Quote: ... 5 μg-mL-1 insulin (Sigma-Aldrich), 1 μg-mL-1 hydrocortisone (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... and 5 IU mL−1 benzonaze (Sigma), respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted 1:1,000 in 5% BSA (Sigma).
-
bioRxiv - Cancer Biology 2023Quote: ... diluted 1:1,000 in 5% BSA (Sigma), mouse anti-β-Actin antibody (Millipore Sigma A5441 ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted 1:5,000 in 5% BSA (Sigma), and rabbit anti-RARS (Proteintech ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μM Ferrostatin-1 (SML0583, Sigma-Aldrich), 50 μM Z-VAD-FMK (14463 ...
-
bioRxiv - Microbiology 2023Quote: ... 1/5 volume of resazurin (Sigma-Aldrich; 0.15 mg/ml in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Microbiology 2024Quote: ... Trimetoprim: Sulphametoxazole (1:5 ratio) (Sigma, MedChemExpress) were determined using the standard microbroth dilution protocol68 and interpreted using the European Committee on Antimicrobial Susceptibility Testing (EUCAST ...
-
bioRxiv - Immunology 2024Quote: ... 5-azacytidine (1 μM; Sigma‒Aldrich, #A2385), or ATRA (100 and 1000 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... insulin (5 μg ml−1, Sigma I1882), and ascorbic acid (0.05 mg ml−1 ...
-
bioRxiv - Biochemistry 2021Quote: All reactions were performed in Ub-AMC assay buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, 1 mM ATP, 5 mM MgCl2, 1 mM DTT, and 1 mg/mL ovalbumin [Sigma]), with a final reaction vol of 20 μL per assay in a 384-well plate (Corning) ...
-
bioRxiv - Genetics 2021Quote: ... was propagated and maintained by transferring shoot segments of 3-4 cm with 1-2 young leaves to fresh one-half Murashige and Skoog (Beijing, China, Sigma-Aldrich). Plantlets were grown at 23 ℃ under a 16 h light/8 h dark cycle with a light intensity of illumination of 5000 lux provided by cool white fluorescent lamp tubes ...