Labshake search
Citations for Millipore Sigma :
1101 - 1150 of 10000+ citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... mouse α-tubulin (1:10,000, B-5-1-2, Sigma Aldrich). Secondary HRP-conjugated antibodies (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: ... SSEA-4 (Millipore, Cat. # MAB4304; 1:100), TRA-1-60 (eBioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... syntaxin-4 (rabbit, Millipore AB5330, 1:1000), TMED9 (rabbit ...
-
bioRxiv - Microbiology 2020Quote: ... Calpain 4 (1:500, MAB3083, Merck Millipore), Calpastatin (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µM (Z)-4-hydroxytamoxifen (Sigma H7904) was added to the slice culture medium to induce Cre-activation ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-aquaporin 4 (Sigma, A5971, 1:500), anti-ephb4 (R&D Systems ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 1:4 volume of chloroform (Sigma) was then added to each sample and incubated at room temperature for 3 min followed centrifugation at 12,000 3 g at 4C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... 4-chloro-1-napthol substrate (Sigma-Aldrich) was added for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 µM Ethidium homodimer-1 (Sigma #E1903 ...
-
bioRxiv - Physiology 2024Quote: ... 1 μM 4-OH-tamoxifen (SML1666, Sigma) or vehicle (EtOH ...
-
bioRxiv - Biophysics 2024Quote: ... 4 g L-1 glucose (Sigma-Aldrich), 25 mM MOPS (Sigma-Aldrich ...
-
bioRxiv - Pathology 2024Quote: ... anti-GFAP (1:400, GA-4, Sigma), anti-nitrotyrosine (1:300 ...
-
bioRxiv - Bioengineering 2021Quote: Before staining with either 5-bromo-4-chloro-3′-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, Sigma-Aldrich) for alkaline phosphatase (ALP ...
-
bioRxiv - Developmental Biology 2021Quote: ... and color was developed with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma). Following color development ...
-
bioRxiv - Neuroscience 2023Quote: ... Larvae were incubated overnight from 4 dpf in 3 ml 10 mM 5-Bromo-2′-deoxyuridine (B5002, Sigma) with 1% DMSO for 17 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bands were stained in 5-bromo-4-chloro-3-indolyl-phosphate and nitro blue tetrazolium solution (Sigma-Aldrich). The membrane image was acquired using a digital steel camera EOS M6 mark II with a lens EF16-35 mm F4L IS USM (Canon Inc. ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: A total of 150 µL of 3% 4-ethoxymethylene-2-phenyl-2-oxazolin-5-one (oxazolone; Sigma-Aldrich) dissolved in 100% ethanol (Wako ...
-
bioRxiv - Cell Biology 2020Quote: ... and Ypt1-7xHis were mixed in a 1:3 molar ratio and incubated overnight at 4°C with calf intestinal alkaline phosphatase (Sigma) to hydrolyze nucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) twice with 300 μL of Elution buffer (Lysis buffer A with 1 mg/mL 3 × FLAG peptide (Sigma)) ...
-
bioRxiv - Microbiology 2020Quote: ... Immunoprecipitation was performed at 4°C overnight with nutation in 1 ml chromatin aliquots with 3 ul of anti-FLAG M2 antibody (F3165, Sigma) and 20 ul of Protein G Dynabeads (Invitrogen) ...
-
bioRxiv - Physiology 2023Quote: ... Following overnight incubation at 4°C with primary antibodies against CARNS1 (rabbit polyclonal, 1:1000 in 3% milk/TBS-T, HPA038569, Sigma), membranes were washed (3 × 5 min) ...
-
bioRxiv - Cell Biology 2023Quote: ... (phenylmethylsulfonyl fluoride, PMSF 1mM; 1-chloro-3-tosylamido-4-phenyl-2-butanone, TPCK, 10 μg/ml; aprotinin, 10 μg/ml Sigma) incubated for 30min on ice ...
-
bioRxiv - Developmental Biology 2022Quote: ... Prior to start of imaging 6.5 ml culture medium with 1 μg/ml 17alpha,20beta-Dihydroxy-4-pregnen-3-one (DHP, diluted in 100% Ethanol, Sigma) containing drug/Lysotracker was added on top of the solidified LMP agarose ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified proMMP-3 and mutants were activated for 16 h in the presence of 1 mM 4-amino-phenyl mercuric acetate (Sigma) at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... alpha-cyano-4-hydroxycinnamic acid (CHCA) and Trifluoroacetic acid (TFA) were purchased from Sigma-Aldrich. Histological-grade xylenes was purchased from Spectrum Chemical ...
-
bioRxiv - Pathology 2022Quote: ... Day 7 differentiated WT and ABHD4 KO 3T3-L1 adipocytes were labeled with 0.5 μCi [14C]-acetic acid or 5 μCi [3H]-oleic acid plus 0.04 mM oleic acid (Sigma-Aldrich) conjugated with 0.01 mM fatty acid free-bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2021Quote: ... and blocked during 1 h with 3 % BSA (Probumin) or 1% gelatin (Sigma) in PBS ...
-
bioRxiv - Biochemistry 2020Quote: The S-variant and RBD coupled bead sets were incubated with SARS-CoV-2 patient sera at 3 dilutions (1/100; 1/1000 and 1/10000) for 1 h in 96-well filter plates (MultiScreenHTS; Millipore) at room temperature in the dark on a horizontal shaker ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... for 1 hour and 1 μg/ml Laminin2020 for 4 hours (Sigma). Cells were cultured on NES culture medium contained DMEM/F12+GlutaMax (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/mL interleukin-4 (IL-4, Sigma-Aldrich) and 0.5 μg/mL anti-CD180 (BD PharMingen) ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors (Sigma cocktail 3, 1:100 dilution) and 100 nM okadaic acid ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 3-isobutyl-1-methylxanthine (IBMX; Sigma) to inhibit phosphodiesterase cAMP degradation ...