Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for High mobility group protein B1 HMGB1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Biotinylated DNA was generating using a forward primer containing a Biotin TEG group on the 5’ end obtained from Sigma Aldrich: Biotin TEG 5’ ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were randomly divided in 4 groups of 10 individuals each: SD and HFD mice treated with vehicle (VEH; 0.3% Arabic gum solution; G9752, Sigma-Aldrich, France), and SD and HFD mice treated with a LA solution (0.2% LA in VEH ...
-
bioRxiv - Immunology 2023Quote: Harvested tissues (right lobe of lungs/half spleen) of each mouse belonging to 2M/17M age groups were incubated with collagenase D (1 µg/mL, Sigma, #11088866001) and DNase I (0.5 mg/mL ...
-
bioRxiv - Cell Biology 2023Quote: Mice either received an intraperitoneal injection of PBS (10 mL/kg, control group) or tunicamycin (T7765, Sigma-Aldrich; 2 mg/kg) or two injections of rapamycin (R-5000 ...
-
bioRxiv - Microbiology 2023Quote: Bacterial strains used in this study were cultured in Miller’s Lysogeny Broth (LB) or on LB solidified with 1.5% agar (Novagen, Merck Group, Germany). When required ...
-
bioRxiv - Immunology 2023Quote: ... Each group (n = 6) was immunized intraperitoneally with peptides-KLH (10 μg/mouse) emulsified in Incomplete Freund’s Adjuvant (Sigma, Cat.#F5506), and a control group (n = 6 ...
-
bioRxiv - Neuroscience 2023Quote: ... The two monkeys in the MPTP treatment group received repeated injections (i.m.) of low doses of MPTP (0.2–0.7 mg/kg; Sigma-Aldrich, St Louis, USA) delivered at least one week apart until a moderate and stable state of parkinsonism emerged ...
-
bioRxiv - Biochemistry 2023Quote: ... Serum samples were collected from surviving mice and 3 samples from each group were used for estimation of Creatine Kinase activity Assay Kit (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2023Quote: Female mice (n=5-7 per group) were fasted overnight and then injected with poloxamer 407 intraperitoneally (1 g/kg BW) (Sigma, 16758). Plasma TG concentrations were measured at 0 ...
-
bioRxiv - Biochemistry 2023Quote: ... the tips were functionalized overnight with a self-assembled monolayer (SAM) solution terminating in phosphate (PO43-) end group (Sigma-Aldrich, 754269). Then ...
-
bioRxiv - Molecular Biology 2023Quote: To establish folic acid (FA)-induced nephropathy, mice (25-30g, n= 6-10 mice per group) were injected intraperitoneally with FA (F7876, Sigma-Aldrich, dissolved in 0.3M sodium bicarbonate at a dose of 250 mg/kg) ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were randomized to treatment groups based on cage ID number and received either 160mg/kg 4-vinylcyclohexene diepoxide (VCD; Sigma #V3630) or vehicle (sesame oil ...
-
bioRxiv - Molecular Biology 2023Quote: ... HeLa Kyoto cells (a kind gift from the Ellenberg group, EMBL) and HEK293T cells were cultured in DMEM (Sigma-Aldrich, D5648) containing 4.5 mg ml−1 glucose ...
-
bioRxiv - Cancer Biology 2023Quote: ... in drinking water) or the treatment group (2 mg/ml Dox Beladox, bela-pharm) and 50 mg/ml sucrose (Sigma-Aldrich) in drinking water ...
-
bioRxiv - Microbiology 2023Quote: ... The normal group was intraperitoneally administered a dose of 8 mL/kg of 0.5% carboxy methyl cellulose (Sigma-Aldrich, MO, USA) as an excipient ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The assessment of the maturation rate of the groups containing COCs required a stripping step to remove the surrounding cumulus and corona cells via hyaluronidase treatment (Sigma-Aldrich) prior to oocyte evaluation ...
-
bioRxiv - Cell Biology 2024Quote: ... animals in the D-GAL groups received during 13 weeks daily intraperitoneal (IP) injections of 600 mg/kg of D-galactose (D-gal, G53688, Sigma Aldrich) resuspended in phosphate buffered saline (PBS ...
-
Cellulose fermentation by the gut microbiota is likely not essential for the nutrition of millipedesbioRxiv - Microbiology 2024Quote: ... while the other two groups were fed litter treated with 5 mM or 10 mM of Sodium 2-bromoethanesulfonate (Na-BES; Sigma-Aldrich) to inhibit methanogenesis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR CCR5 locus insert cell lines were grown in Dulbecco’s Modified Essential Medium High Glucose (DMEM-high Glucose) (Sigma-Aldrich) with 10% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... and proteins precipitated using protein-A Agarose (Sigma-Aldrich) prior to analyses by Western blotting.
-
bioRxiv - Microbiology 2022Quote: ... proteins proteins were electrophoretically transferred to nitrocellulose membranes (Millipore) using a Transblot semi-dry transfer cell (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified 1,297 RT-PCR products were digested with MluI (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... and Expand high-fidelity PCR system (Sigma-Aldrich). RT-PCR products were purified on 0.7% agarose gel and subjected to Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5% CO2 in high-glucose DMEM (Sigma, D5671) supplemented with 10% FBS (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 in high-glucose DMEM (Sigma, D5671) supplemented with 10% FBS (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... They were cultured in DMEM (high glucose; Sigma) supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were subjected to 0.7% agarose gel analysis and the gel-purified PCR fragments were subjected to sanger sequencing (ACGT) ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR system (Sigma Aldrich). Amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... in DMEM/High glucose (Sigma-Aldrich, UK, D6429) media containing 1% Non-Essential Amino Acids and 10% foetal calf serum (both from Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2020Quote: ... growth media (DMEM high glucose (Sigma, Catalogue # D6546) supplemented with 2mM L-Glutamine (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). The amplified DNA products were separated on a 0.7% agarose gel ...
-
bioRxiv - Pathology 2021Quote: High (HT1197; ATCC) and low (RT112, Sigma-Aldrich) grade urinary bladder carcinoma epithelium cells were cultured in 1:1 mixture of DMEM and Hams-F12 medium supplemented with 5% fetal bovine serum and 2 mM LGlutamine ...
-
bioRxiv - Genomics 2021Quote: ... high BSA growth medium (DMEM with1% BSA (Sigma) and 1% penicillin/streptomycin (GIBCO) ...
-
bioRxiv - Genetics 2020Quote: ... Glutathione High Capacity Magnetic Agarose Beads (Sigma G0924) were added and the mixture was rotated 1 hour at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... and high-resolution agarose were purchased from Sigma-Millipore (MA) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... were purchased in high purity from Sigma-Aldrich and Cayman Chemical ...
-
bioRxiv - Microbiology 2022Quote: ... and Expanded High Fidelity PCR System (Sigma Aldrich). Amplified DNA products ...
-
bioRxiv - Neuroscience 2022Quote: ... High ovomucoid solution (0.030 g/ml BSA (Sigma), 0.030g/ml trypsin inhibitor (Worthington) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... we obtained high-purity compounds from Sigma-Aldrich: econazole nitrate (catalogue number E0050000) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were cultured in high glucose DMEM (Sigma) supplemented with 10% fetal bovine serum (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... containing 0.75% carboxymethylcellulose (Sigma-Aldrich, high viscosity grade) and incubated for 48 h (37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in high-glucose DMEM (Sigma Aldrich) supplemented with fetal calf serum (10% ...
-
bioRxiv - Cancer Biology 2023Quote: ... DMEM high glucose medium with glutamine (D6429, Sigma), supplemented with 10% FBS (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... consisting of DMEM-high glucose (Sigma-Aldrich, #D5671), supplemented with 10% heat-inactivated fetal bovine serum (R&D Systems ...
-
bioRxiv - Molecular Biology 2023Quote: ... DMEM10% consists of DMEM high-glucose (Sigma-Aldrich) supplemented with 10% foetal calf serum (PanBiotech) ...
-
bioRxiv - Cell Biology 2024Quote: ... 12 g of high viscosity methylcellulose (Sigma, M0512) were dissolved in one liter of RPMI1640 ...