Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Secondary antibodies were diluted in PBS and sections were incubated for 1 hour at room temperature with 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) for nuclei visualization ...
-
bioRxiv - Immunology 2020Quote: ... Then the slips were washed with PBS for three times, and after that the hemocytes were stained with DAPI (4’, 6-diamidino-2-phenylindole) (50 ng/ml) (Sigma, USA) for 5 min [55] ...
-
bioRxiv - Microbiology 2021Quote: ... cells from control and experimental culture were washed with PBS and mounted with DAPI (4’,6-diamidino-2-phenylindole) over glass slides using slide mounting media from Sigma-Aldrich and observed under the fluorescent microscope ...
-
bioRxiv - Genetics 2022Quote: ... Bb was cultured at 37ºC in Barbour-Stonner-Kelly with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer media (BSK-H) complete with 6% rabbit serum (Millipore Sigma) and 1% Amphotericin B (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The remaining 2 ml were added to falcon tubes containing 4 ml of 6 M GndHCl (Sigma Aldrich, Saint Louis, Missouri) and mixed thoroughly to denature the samples ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were washed again for three times before the final staining of the nuclei using 4’,6-diamidin-2-phenylindol (DAPI, Sigma-Aldrich). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... To identify the total number of cells the nuclei were stained with DAPI (4’, 6-Diamino-2-phenylindole dihydrochloride) (1:10000, Millipore-Sigma). Images were acquired using Olympus BX61 microscope and analyzed using Fiji software (ImageJ).
-
bioRxiv - Microbiology 2021Quote: ... Samples were then dried in 80% ethanol and mount on a glass slide with antifadent AF1 (Citifluor, USA) added with 4’-6’-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) for counterstain at a final concentration of 2 μg.ml−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... C9H2Cl4O2 was purchased from Tebu-Bio and used at 2μM working concentration. Monastrol (Ref. M8515) and 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (Ref. D8417) were purchased from Sigma-Aldrich. S-Trityl-L-cysteine (STLC) ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated for 20 minutes at room temperature with DAPI (4',6-diamidino-2-phenylindole; 1:150000, Sigma-Aldrich), mounted on glass slides with Fluoromount-G (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Bioengineering 2023Quote: Nuclear DNA integrity and gross cell morphology in dPPM was assessed with 4’,6’- diamidino - 2 - phenyl indole (DAPI, Sigma-Aldrich) staining and fluorescence microscopy (Nikon Eclipse Ti ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was counterstained with DAPI (4′,6-diamidino-2-phenylindole, 10 μg/ml, Cat.No.: D27802, Sigma-Aldrich Chemie GmbH, Steinheim, Germany) for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... cells were washed thrice with 1×PBS and incubated for 15 min at RT with 0.1 µg/ml of 4’,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, Poland). After a final three washes with 1×PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated with PBG blocking buffer containing secondary antibodies and 0.4 μg/ml DAPI (4’,6-diaminido-2-phenylindole, Sigma, cat # D9542) for 1 h ...
-
bioRxiv - Systems Biology 2022Quote: ... cells were washed with PBS and their nuclei were stained with 200 ng/mL 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) for 10 min ...
-
bioRxiv - Bioengineering 2024Quote: ... The samples were then washed three times in PBS and incubated with 4’-6-diamidino-2-phenylindole (DAPI) (1:1000; Sigma-Aldrich) at room temperature for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated in blocking buffer containing secondary antibodies and 0.5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich #D9542) for one hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... ovaries were washed for 1 h with PBX and stained with 1 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI) (SIGMA, USA) for 10 min in PBX ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 1 min with 4’,6-diamidino-2-phenylindole (DAPI; 0.5 μg/ml, Sigma-Aldrich, cat# D8417) diluted in PBS to label cell nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were mounted on glass microscopy slides with DAPI-containing mounting medium (4’,6-Diamidino-2-phenylindole dihydrochloride, Vectashield-H-1200-10, Sigma-Aldrich). All brain slices were imaged by a confocal microscope (LSM 710 ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at room temperature simultaneously with 4′,6-diamidino-2-phenylindole (DAPI: 1:2500, D9542; Sigma-Aldrich-Aldrich, USA) and Phalloidin Alexa488 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were labeled with 4’,6-Diamidino-2-Phenylindole (DAPI) and slides were mounted using Fluoromount mounting medium (Sigma, cat. # F4680).
-
bioRxiv - Neuroscience 2024Quote: ... the sections were rinsed in PBS followed by a nuclear staining with DAPI (4’,6-diamidino-2-fenylindool, 1:1000 in PBS, 32670, Sigma-Aldrich). All sections were mounted with Mowiol and a glass cover slide ...
-
bioRxiv - Cell Biology 2024Quote: Cells were cultured in 6-well plates with EGM-2 medium supplemented with 4% dextran (Sigma-Aldrich, St. Louis, MO, 31392). Hemodynamic flows were applied to using a 1o tapered stainless steel motorised cone (UMD-17 (Arcus20 Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were washed twice at RT with 0.1% Triton 100X in PBS and then counterstaining with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (1:5000, Sigma Millipore, #MBD0015) in PBS for five minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were washed twice at RT with 0.1% Triton 100X in PBS and then counterstaining with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (1:5000, Sigma Millipore, #MBD0015) in PBS for five minutes ...
-
bioRxiv - Immunology 2024Quote: ... Dpt+ fibroblasts were cultivated by injecting (i.p.) iDpt;R26YFP-CTRL and iDpt;R26YFP;Csf1fl/f Exons 4–6 mice with 2 mg tamoxifen (Sigma, cat# T5648) diluted in sunflower seed oil (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were washed twice with PBS and counterstained with 1 µg mL-1 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) to distinguish between live and dead cells ...
-
bioRxiv - Bioengineering 2024Quote: ... The samples were washed thrice with PBS and then mounted using a mounting media containing 100 nM 4’,6-diamidino-2-phenylindole (DAPI) (Fluoroshield with DAPI, Sigma-Aldrich) for counterstaining DNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... Worms were then washed 2x in PBSTx and counterstained via a 20-min incubation in 1:1000 4′,6-diamidino-2-phenylindole (DAPI, 1 mg/ml, Sigma Aldrich) in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Developmental Biology 2021Quote: Larvae at 2-6 dpf were first anesthetized with 0.03 % Ethyl 3-aminobenzoate methane sulfonate salt (Sigma-Aldrich, St. Louis, MO, USA) and pinned onto a Sylgard-filled recording chamber (I-2450 ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were spin-infected at a 0.3 multiplicity of infection in the presence of DMEM (10% FBS, 1% L-Glutamine) and hexadimethrine bromide (8ug/ml) (Sigma-Aldrich, 107689) at 2000 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... To prevent movements and EMG contamination of the phrenic neurogram pancuronium bromide was administered (3 mg/kg IV, Sigma-Aldrich, St Louis) to achieve neuromuscular blockade ...
-
bioRxiv - Neuroscience 2021Quote: ... 6; MgCl2, 4; CaCl2, 5; sucrose, 160; glucose, 25; Hepes, 10; pH 6.7, 500 mOsmol; all chemicals from Sigma-Aldrich, Lyon, France), to avoid desiccation of the brain surface ...
-
bioRxiv - Neuroscience 2023Quote: ... then in the anti-dopamine receptor antibody diluted in the blocking solution for 5-6 days at 4°C (rabbit anti-dopamine D1A receptor, 1:100, Sigma-Aldrich AB1765P). Sections were washed in PBS and incubated for 2 h at RT in the secondary antibody (goat anti-rabbit Alexa Fluor 555) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrates (Sigma-Aldrich) in NTM (100mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... and the blotting signals were chemically visualized with either the nitro-blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate (NBT/BCIP) chromogenic assay (Sigma) or infrared scanner ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with antibodies (5-8 μg) overnight at 4°C followed by incubation for 3 hours with protein G-sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... coli DH5α cells were transformed with the resulting pho-lac fusion plasmids and streaked on dual indicator plates containing LB agar with 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) (Sigma) at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal ...
-
bioRxiv - Microbiology 2021Quote: ... Immunoreactive bands were detected by the addition of BCIP (5-bromo-4-chloro-3-indolylphosphate)-nitroblue tetrazolium solution (Sigma-Aldrich). The reaction was stopped after 2 min by washing the blots with large volumes of deionized water.
-
bioRxiv - Bioengineering 2021Quote: ... slides were either treated with SIGMA FAST™ BCIP/NBT (5-Bromo-4-chloro-3-indolulphosphate/Nitro blue tetrazolium, pH 9.5, Sigma) and counterstained with nuclear fast red (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated in NBT (nitro-tetrazolium blue)-BCIP (5 bromo-4-chloro-3’-indolyphosphate p-toluidine) (Sigma-Aldrich), 0.033% in APTMg in dark condition ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...