Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Biochemistry 2020Quote: ... were pooled together (6 mL) and concentrated/buffer exchanged using an Amicon® Ultra-4 Centrifugal Filter Units (3 kDa, Millipore, Ireland). The final volume of the purified bacteriocin protein fraction was reduced to 200 μL ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Zoology 2022Quote: ... Samples were then immersed in 75% v/v benzyl-benzoate (Sigma-Aldrich; B6630) with 25% v/v polyethylene glycol (BB-PEG ...
-
bioRxiv - Neuroscience 2023Quote: ... and in the end in a mixture of benzyl alcohol (Sigma-Aldrich, 24122) and benzyl benzoate (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... samples were taken up in a 1:1 (v/v) mixture of 100% MeOH and a 2:1 (v/v) mixture of benzyl alcohol (Sigma Aldrich, Saint Louis, USA) and benzyl benzoate (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were incubated with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, cat. D8517, Sigma Aldrich, St. Louis, MO, USA) diluted 1:3000 in PBS 1X and then mounted with Vectashield antifade medium (cat ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were fixed using 70% Ethanol and re-suspended in PBS containing 1 μg/ml 4’,6-diamino-2-phenylindole (DAPI, Sigma) and analyzed by microscopy ...
-
bioRxiv - Developmental Biology 2022Quote: ... in PBST and then counterstained with 4’,6-diamidino-2-phenylindole (DAPI; 0.001 mg/mL in 1x PBS, Sigma-Aldrich) for 5 min in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... after which we incubated a 20µL pre-isolation aliquot of the filtrate with 0.1µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Millipore-Sigma, cat. #D9542) and mounted on a slide for imaging (Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... after which we incubated a 20µL pre-isolation aliquot of the filtrate with 0.1µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Millipore-Sigma, cat. #D9542) and mounted on a slide for imaging (Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... and bacterial nucleoids stained by topping cells with a drop of Fluoroshield™ containing 1.5 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Cover slips were placed over the samples and kept at room temperature for ∼ 30 minutes before cells were imaged.
-
bioRxiv - Physiology 2020Quote: ... Dead cells and debris were excluded by measurements of forward-versus side-scattered light and DAPI (4′,6-diamino-2-phenylindole) (Sigma) staining ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... the tissue and cells were incubated in 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI, D-6564, Sigma, 1:1000). Biotinylated-secondary antibodies were from Vector Labs ...
-
bioRxiv - Immunology 2022Quote: ... For cell sorting cell suspensions were stained for viability with 1:3000 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) immediately before sorting.
-
bioRxiv - Developmental Biology 2022Quote: ... sections were washed in PBS and then incubated for 10 minutes in 1:10000 4’,6-diamidino-2-fenilindol (DAPI; Sigma) for nuclei counterstaining ...
-
bioRxiv - Neuroscience 2020Quote: ... After rinsing sections were incubated 10 min at room temperature (RT) with 0.001 % DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, Sigma, D9542) in PBS for nuclear staining ...
-
bioRxiv - Immunology 2022Quote: ... The sections were washed in PBS and incubated 10 min with 4’,6-diamidino-2-phenylindole (DAPI, 1/10,000, Sigma-Aldrich) to visualize the cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... To identify the total number of cells the nuclei were stained with DAPI (4’, 6-Diamino-2-phenylindole dihydrochloride) (1:10000, Millipore-Sigma). Images were acquired using Olympus BX61 microscope and analyzed using Fiji software (ImageJ).
-
bioRxiv - Developmental Biology 2020Quote: ... An incubation was done 45 min at room temperature with a mix of 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, 1µg/mL, 10236276001, Sigma-Aldrich) and the secondary antibody Donkey anti-Mouse Alexa Fluor 555 in PBS 1X ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were washed with staining medium and re-suspended in 4’,6-diamidino-2-phenylindole (DAPI; 1 μg/ml; Sigma) to eliminate dead cells from sorts and analyses ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were mounted in Sigma-Aldrich DuoLink in situ mounting medium with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich), allowed to incubate at room temperature (RT ...
-
bioRxiv - Microbiology 2023Quote: ... quenched with 25 mM ammonium chloride in PBS for 10 min and nuclei were stained with 4’,6-diamidino-2-phenylindol (DAPI, Sigma, cat ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 30min at room temperature (10µg/mL, D9542, Sigma-Aldrich). Coverslips were mounted with ProLong Gold Antifade (P36934 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... slides were washed for 5 min in 0.1x SSC with 1% Triton X-100 at 62°C and counterstained with 0.5 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich) in antifade with DABCO (1,4-diazabicyclo (2.2.2)-octane ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with staining medium and re-suspended in staining media supplemented with 4’,6-diamidino-2-phenylindole (DAPI; 1 μg/ml; Sigma) to eliminate dead cells from analyses ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with staining medium and re-suspended in 4’,6-diamidino-2-phenylindole (DAPI; 1 μg/ml; Sigma) to eliminate dead cells from sorts and analyses ...
-
bioRxiv - Bioengineering 2024Quote: ... The slides were then washed with 0.1% Tris-buffered saline and Tween-20 (TBST) prior to 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining (D9542 Sigma) for nuclei visualization ...
-
bioRxiv - Immunology 2022Quote: ... The sections were then washed with PBS/0.5% Triton and counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Digitally scanned sections were analysed using Image Scope software (Scanscope XT ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were washed several times in PBS and incubated with 1 µg/mL of 4’,6-diamidino-2-phenylindole (DAPI) (Sigma) to visualize the nuclei.
-
bioRxiv - Immunology 2023Quote: 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) was used to exclude dead cells and debris (Sigma Aldrich, St. Louis, MO). All antibodies are from Biolegend ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed with PBS and the cells’ nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1.5 μg/mL, Sigma-Aldrich) for 5 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2024Quote: ... the respective secondary antibodies were incubated in ADB at room temperature in the dark for 90 min together with 0.5 µg/mL 4′,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich). Before imaging the cells were washed again using PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... samples were washed in 1X PBS and incubated with DAPI (4-6-diamidino-2-phenylindole, Sigma-Aldrich, 1 µg/mL) for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... coverslips were incubated for 1 h in blocking medium containing the appropriate secondary antibody and 0.1 μg 4’,6-diamidine-2’-phenylindole (DAPI; Sigma-Aldrich). After three washes with PBS-T plus one additional washing step with PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed in PBS and further incubated for 15 min at room temperature with DAPI (4’, 6-diamidino-2-phenylindole, 1:5000, Sigma). Incubation with the secondary antibody lasted for 3 h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Fluorescent phalloidin was used to stain filamentous actin and DAPI (4′,6-diamidino-2-phenylindole) was used to stain nuclei (Sigma). Of note ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x 30 min with 5×SSCT containing 4′,6-diamidino-2-phenylindole (DAPI, 1μg/ml, #62248, ThermoFischer) and/or Phalloidin Atto 565 (1:50, #94072, Sigma Aldrich), and 1x 5min in 5xSCCT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sections were washed in PBS and further incubated for 15 min at room temperature with DAPI (4’,6-diamidino-2-phenylindole, 1:5000, Sigma). Incubation with the secondary antibody lasted for 3 h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... at 4 °C in a 6–30% OptiPrep (Sigma- Aldrich ...