Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for 5 FLUORO 2 PHENYLBENZO D THIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... culture medium was replaced with S1-media (Final 11,6 g/L MCDB131, Sigma Aldrich, M8537-1L; 2 mM D-+-Glucose, Sigma Aldrich, G7528-250G ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... of liver homogenate (0.08 M NaPO4) was mixed with 30 μL of p-nitrophenyl-2-acetamide-β-D-glucopyranoside (Sigma-Aldrich) and diluted in 50 μL of 50 mM citrate buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μL lysate was mixed with 45 μL MUG (methylumbelliferyl b-D-glucuronide) solution (10 mM Tris/HCl pH 8, 2 mM MgCl2, 1 mM MUG (Sigma Aldrich)) in a 96-well plate ...
-
bioRxiv - Cancer Biology 2023Quote: Cells seeded in six-well plates were cultured overnight with 2 mL fresh medium with or without 25 mM D-glucose-1,2-[13C2] (Sigma-Aldrich, 453188) before treatment ...
-
bioRxiv - Immunology 2023Quote: ... to block the respiratory chain via complex I and 2-deoxy-D-glucose (D8375-10MG; Sigma-Aldrich, St. Louis, MO, USA) of 10mM to inhibit glycolysis.
-
bioRxiv - Neuroscience 2024Quote: ... half of the medium was substituted with a culture medium supplemented with 2% B-27 plus supplement and 5μM of cytosine β-d-arabinofuranoside (Ara-C; Sigma; #C1768). The culture medium was then changed every three days ...
-
bioRxiv - Neuroscience 2024Quote: Aβ1–42 peptides, HFIP (A-1163-2, r-peptide) were dissolved to in anhydrous dimethyl sulfoxide (Hybri-Max D-2650 DMSO, Sigma-Aldrich) to obtain a 2.5mM Aβ stock solution ...
-
bioRxiv - Genetics 2019Quote: ... Deuterated glucose (D-glucose-1,2,3,4,5,6,6-d7) was purchased as 97 atom % D (Sigma).
-
bioRxiv - Cell Biology 2019Quote: ... Media with D-glucose was prepared by adding D-glucose (Sigma Aldrich, USA) to the glucose-free medium at 4.5 g/l final concentration ...
-
bioRxiv - Neuroscience 2021Quote: ... and the N-methyl-D-aspartate receptor agonist D-Glutamate (0.75mM, Sigma-Aldrich) was bath applied to the spinal cord.
-
bioRxiv - Microbiology 2021Quote: ... 200 U/ml of Interferon-aA/D (IFN-aA/D or IFNa, Sigma) was added to the culture media ...
-
bioRxiv - Neuroscience 2022Quote: ... and a final concentration of 45 mM actinomycin D (Act-D, Sigma, No.A1410). Subsequently ...
-
bioRxiv - Microbiology 2019Quote: ... ‘K-A-A’ tripeptide (acetyl-L-Lys-D-Ala-D-Ala) (Sigma-Aldrich) and ‘A-E-Dap’ tripeptide (L-Ala-D-Glu-mDap ...
-
bioRxiv - Neuroscience 2022Quote: ... DRGs from E13.5 embryos were dissected and plated as explants in chambers coated with 10 μg/ml poly-D-ly-sine (Sigma Millipore, catalog #P6407) and 10 μg/ml laminin (Sigma Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... were dissected from E13.5 wild-type mice and plated in a 8-wells chamber coated with 10µg/ml poly-d-lysin (Sigma-Aldrich, St Louis, MO) and 10µg/ml mouse Laminin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... Lymph nodes were transferred to digestion media (HBSS, 5% Fetal Calf Serum, 1% HEPES) containing 500U/mL of Collagenase D (Sigma-Aldrich, Cat 11088866001) and 20 mg/mL of DNAse I ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 in DMEM:F12 containing 1% pen-strep and 10% FBS on 5 poly-D-lysine (PDL; P7405- 5MG; Sigma-Aldrich, St. Louis, MO) coated T-75 flasks ...
-
bioRxiv - Biophysics 2024Quote: ... The experiment involved growing cells in three different glucose concentrations: normoglycemic control (NG) with 5 mM D-glucose (cat. No. G8270 Sigma-Aldrich, Darmstadt, Germany), medium hyperglycemia conditions (MDM ...
-
bioRxiv - Biophysics 2024Quote: ... Columns were then washed with 5 column volumes of K+-Tris buffer and protein as eluted using 2.5 mM d-desthiobiotin (Sigma-Aldrich, St. Louis, MO) in K+-Tris buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... nuclei were stained with DAPI (2 μg/ml, room temperature, 5 min, Sigma, St. Louis, Missouri, USA).
-
bioRxiv - Plant Biology 2022Quote: ... DSF supplementation was performed by adding with 5 μM of cis-11-methyl-2-dodecenoic acid (Sigma) to the media.
-
bioRxiv - Molecular Biology 2020Quote: ... 10% FCS and human fibroblast growth factor-2 (5 ng/mL, Sigma-Aldrich, St Louis, MO, USA) at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... yeasts were incubated in 1 mL of 5% 2-mercaptoethanol in SPM buffer (Sorbitol 1.2 M (Sigma), potassium phosphate monobasic 50 mM (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: Mouse monoclonal α-Flag (M2) and α-tubulin (clone B-5-1-2) were obtained from Sigma. Rabbit polyclonal α-HA (ab9110 ...
-
bioRxiv - Physiology 2020Quote: ... 5 mM glucose and 2% BSA for two hours while treated with 1 μM isoproterenol (Sigma-Aldrich), 10 μM forskolin with 0.5 mM IBMX (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Microbiology 2021Quote: ... The minimal medium was supplemented with 5 mM 2-(N-morpholino) ethanesulfonic acid (Mes: Sigma Chemical Co.) adjusted to pH 6.4 with NaOH as buffer and 0.5% (w/v ...
-
bioRxiv - Microbiology 2021Quote: 20 μg of fraction 19 were reduced with 5 mM Tris(2-carboxyethyl)phosphine (646547, Sigma Aldrich) for 60 min at 65 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Continuous culture was typically carried at 2-5%-hematocrit in RPMI-1640 (Sigma Aldrich, Cat. No. R6504) supplemented with HEPES ...
-
bioRxiv - Immunology 2022Quote: Total RNA was collected from cultured cells treated with 100 nM 5-aza-2⍰-deoxycytidine (decitabine; Sigma) or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were combined with NuPage LDS sample buffer 4x (#2083421) and 5% 2-Mercaptoethanol (Sigma Aldrich #M6250) and heated for 10 minutes at 70°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Synthetic Biology 2019Quote: Replica-plated cell populations were treated with varying concentrations of 5-aza-2’-deoxycytidine (Sigma-Aldrich, A3656) or Trichostatin A (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... before fixation for 5 hrs in humid conditions at 37 °C in 1.4% / 2% formaldehyde (F8775 Sigma) / acrylamide (A4058 Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2020Quote: All birds received intramuscular injections of 5-Bromo-2’-deoxyuridine (BrdU; 74 μg/g, pH 7.4, Sigma) 3x/day for three days to label mitotically active cells ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of 4-amino-5 methylamino-2’ s,7’-difluorofluorescein (DAF-FM) diacetate (Sigma, D1946). DAF fluorescence intensities were measured every 5 minutes for a total of 60 minutes using a SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then blocked for 2☐h in 5% bovine serum albumin (BSA, Sigma-Aldrich, A7906) in 0.01☐M PBS and 0.3% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... the cells were spun down and moved to “Phase 2” IMDM media containing 5% human serum (Sigma), 330µg/mL transferrin ...
-
bioRxiv - Cancer Biology 2022Quote: ... S-phase populations were identified by incorporation of 10 μM 5-ethynyl-2’-deoxyuridine (EdU; Sigma-Aldrich) 45 min before fixation ...
-
bioRxiv - Cell Biology 2022Quote: ... A small piece of frozen BAT (2 – 5 mg) was transferred into a BeadBug tube (Sigma Aldrich) containing 1.0 mm zirconium beads (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: Time-pregnant mice were injected with 5-bromo-2’deoxyuridine (BrdU) (50 mg/kg body weight, Sigma) 1 h before the harvest of embryos ...
-
bioRxiv - Neuroscience 2023Quote: Mice were injected intraperitoneally (i.p.) once with 150 mg/kg of 5-bromo-2′-deoxyuridine (BrdU; Sigma) 24 hours before sacrifice for cell proliferation assessment ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Neuroscience 2023Quote: ... short term neighbor rescue experiment NSCs were incubated with 20 µM 5-bromo-2’-deoxyuridine (BrdU) (Sigma) for 2 hours then fixed with 4% paraformaldehyde prior to immunohistochemical processing ...
-
bioRxiv - Cell Biology 2023Quote: ... The dermis was injected with approximately 2-5 μl TAT-Cre recombinase (200 U/ml; Sigma-Aldrich) using a glass microcapillary pipette ...
-
bioRxiv - Genomics 2023Quote: ... about 107 exponentially growing cells were pulse-labelled with 5-Bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich #B9285) for 1 h and sorted into four S-phase fractions ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...