Labshake search
Citations for Millipore Sigma :
1101 - 1150 of 10000+ citations for 5 FLUORO 2 PHENYLBENZO D THIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... actinomycin D (Sigma, #A9415), everolimus (Sellekchem ...
-
bioRxiv - Cell Biology 2020Quote: ... 30% D-glucose (Sigma) and 1.25% SP complete supplements (adenine hemisulfate ...
-
bioRxiv - Immunology 2020Quote: ... Actinomycin D (Sigma-Aldrich) was added (final concentration of 1 µg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... 2.0% D-(+)-raffinose (Sigma), 0.5% D-(+)-melibiose (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5% D-(+)-melibiose (Sigma), 0.5% α-D-glucose (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5% D-(+)-galactose (Sigma), 0.5% β-D-(-)-fructose (MP Biomedicals) ...
-
bioRxiv - Molecular Biology 2020Quote: ... D-Luciferin (Sigma, L9504) was used as a substrate.
-
bioRxiv - Biochemistry 2022Quote: ... and D-methionine (Sigma) included the amino acid added to the cryo-buffer at a concentration of 300 mM and 80 mM respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... D-Glucose (Sigma, G8769), and BSA (Lampire Biological Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... with D-Glucose (Sigma) added up to 6.6mM ...
-
bioRxiv - Immunology 2022Quote: ... D-Mannose (Sigma, Sweden) was supplemented at 100mg/ml when necessary ...
-
bioRxiv - Cell Biology 2022Quote: ... D-mannitol (Sigma-Aldrich) was added to the culture medium of ND-VOs to a final concentration of 33mM ...
-
bioRxiv - Neuroscience 2023Quote: ... D-Mannitol (Sigma-Aldrich) was used as osmotic control (56 mM of Mannitol was added to the 19 mM of glucose already present in the 3D-RDM medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... actinomycin D (Sigma Aldrich) was added to a final concentration of 50 nM and incubated for additional 24 h ...
-
bioRxiv - Microbiology 2023Quote: ... DNase (Sigma-D-4527) and RNase (Sigma-R-5503 ...
-
bioRxiv - Neuroscience 2023Quote: ... Actinomycin D (Sigma A1410) was added during the dissociation process to protect the tissue and prevent activation of immediate early genes 72 ...
-
bioRxiv - Neuroscience 2023Quote: ... and D-polylysine (Millipore)(Archbold et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3c,d (Sigma-Aldrich) or NaveniFlex Cell MR Atto647N kit (Navinci ...
-
bioRxiv - Genomics 2023Quote: ... 5.5mM D-glucose (Sigma) and 750 ng/mL puromycin (InvivoGen) ...
-
bioRxiv - Microbiology 2023Quote: ... D-glucose (Sigma, U.S.A.), yeast nitrogen substrate (Difco ...
-
bioRxiv - Microbiology 2023Quote: ... Actinomycin D (Sigma Aldrich). All chemicals were reconstituted following manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: ... D-luciferin substrate (Sigma) was added to each well to a final concentration of 10 μM ...
-
bioRxiv - Microbiology 2024Quote: Actinomycin D (Sigma-Aldrich) in high to low concentrations (500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ciliobrevin D (250401, Sigma); Erlotinib (SML2156 ...
-
bioRxiv - Neuroscience 2024Quote: D,L-APV (Sigma) dissolved in dH2O and stored at 20 mM was diluted 1:200 into the culture media for a final concentration of 100 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... cytochalasin D (Sigma C2618) at 20 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... Actinomycin D (Sigma Aldrich), Puromycin (Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: ... a sterile β-mercaptoethanol solution was prepared (5 μl of 2-mercaptoethanol (Sigma-Aldrich, Munich, Germany)) in 8.45 ml of PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Brdu-ChIP was performed after addition of 20 μM BrdU (5-bromo-2′-deoxyuridine, Sigma Aldrich) directly to HeLa culture medium for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3.5 minutes at 5 μL/min with 2% Acetonitrile MS grade (Sigma Aldrich, Cat# 1207802), 0.1% formic acid (FA ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... mouse α-tubulin clone B-5-1-2 (1:1000; Sigma Aldrich, San Luis, MO, U.S.). For immunofluorescence primary antibodies were labeled with Alexa-conjugated secondary antibodies Alexa 488 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 -5 mg of MeHA was dissolved in 1 mL Deuterium oxide (D2O) (Sigma Aldrich, 151882) and then tested with 300MHz 1HNMR with 10 ms time scale ...
-
bioRxiv - Microbiology 2020Quote: ... Senescence was induced by treating cells with 100 µM 5-Bromo-2’-deoxyuridine (Sigma Aldrich, USA) for 48 hours ...
-
bioRxiv - Systems Biology 2021Quote: ... the proteins the samples were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP; Sigma-Aldrich) for 20 minutes in 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µM of 5’heyxynyl-dT50 (IDT) were mixed with 2 mM of CuSO4 (SIGMA, C1297) and DDW ...
-
bioRxiv - Microbiology 2022Quote: ... Blocking was performed at room temperature for 2 hours using 5% skimmed milk (70166, Sigma-Aldrich) in 1X PBS containing 0.05% Tween 20 (P1379 ...
-
bioRxiv - Immunology 2022Quote: Neonatal and juvenile mice received daily intraperitoneal injections of 5-aza-2’-deoxycytidine (decitabine, DAC; Sigma) 1 mg/kg (7 ...
-
bioRxiv - Microbiology 2019Quote: ... These bands were first reduced with 5 mM Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich) followed by alkylation with 50 mM iodoacetamide and digested with 1μg trypsin for as long as 16 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... AGS and HUH7 cells pulsed with 10 µM 5-bromo-2′-deoxyuridine (BrdU) (B5002; Sigma-Aldrich) were stained with propidium iodide (P4864 ...
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Cell Biology 2021Quote: ... worms were subsequently mounted on 2% agarose pads and anesthetized with 5 mM tetramisole (Sigma-Aldrich) for observation under a fluorescence microscope.
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Microbiology 2021Quote: ... MNZ (5 uM for 24 hrs) or GSNO (350 μM for 2 hrs) (Sigma-Aldrich, USA) was determined by the eosin dye exclusion method [31].
-
bioRxiv - Molecular Biology 2022Quote: ... Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) 5 mM (Sigma E3889) was added to quench the reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli were also grown in 2 mL Overnight Express Instant TB media (Sigma Aldrich, 71491-5) with added 100 μg/mL ampicillin ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Cell Biology 2023Quote: ... RPMI media containing 5% FBS and 2% w/v bovine serum albumin (BSA; Sigma-Aldrich #A6003). FA mixtures were gently rocked for 1 hour at 37°C to aid conjugation of the fatty acids to BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...