Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for 3 3 17 17 Bis ethylenedioxy 19 hydroxyandrost 5 ene 19 d2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... using either a control normal rabbit IgG or rabbit monoclonal anti-MSI2 antibody and the Magna RIP RNA-binding Protein Immunoprecipitation kit (cat#17-700, Millipore, Burlington, MA). Manufacturer’s instructions were followed with the exception that RNeasy MinElute Cleanup kit (cat#74202 ...
-
bioRxiv - Neuroscience 2024Quote: The genome-wide miRNA screen was performed at the Sanford Burnham Prebys Medical Discovery Institute with 1902 miRNAs (MISSION version 17 library, 1902 miRNAs, Sigma-Aldrich, MI00200). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... then purified proteins were desalted with PD-10 columns (GE, 17-0851-01) and concentrated using Centrifugal Filter Units (EMD Millipore, UFC803008).
-
bioRxiv - Cancer Biology 2022Quote: ... The sonicated nuclear fractions were centrifuged at 10k xg at 4 ⁰C for 10 min and then chromatin immunoprecipitation (ChIP) assay was followed with manufacturers’ guidance for EZ-Magna Chip A/G kit (Millipore, #17-10086) with minor modification ...
-
bioRxiv - Cell Biology 2023Quote: ... using either a control normal rabbit IgG or rabbit monoclonal anti-MSI2 antibody and the Magna RIP RNA-binding Protein Immunoprecipitation kit (cat#17-700, Millipore, Burlington, MA). Manufacturer’s instructions were followed with the exception that RNeasy MinElute Cleanup kit (cat#74202 ...
-
bioRxiv - Immunology 2023Quote: ... Immune mediators in cell culture supernatant following CD3/CD28 bead stimulation were measured using a human premixed CD8+ T Cell Human 17-plex panel (Millipore, Temecula, California). All Luminex assays were analyzed using a MAGPIX Instrument and xPONENT software (Luminex ...
-
bioRxiv - Plant Biology 2024Quote: ... Arabidopsis seedlings were grown for three days on 0.5x MS plates at 17 °C and then transferred to 0.5x MS plates containing 50 µM TG003 (Sigma-Aldrich, Catalogue No.: T5575) or an equivalent volume of DMSO as solvent control and grown for additional two days at 17 °C to allow for uptake of the compound ...
-
bioRxiv - Cell Biology 2024Quote: ... buffered at pH 7 and loaded on a size-exclusion chromatographic (SEC) column (Superdex 200 10/300 GL; Sigma #17-5175-01). The column was equilibrated with NaP buffer at pH 7 and eluted with the same buffer at a rate of 18 mL/h ...
-
bioRxiv - Biochemistry 2024Quote: ... were incubated for 45 min at 4°C with 10 µL agarose beads using a RAS-GTP pull-down assay kit (RAS Activation Assay Kit, Merck Millipore, 17-218). Supernatant was recovered after centrifugation ...
-
bioRxiv - Cell Biology 2024Quote: Cell proliferation assay was performed using an EdU Cell Proliferation Assay Kit (EdU-594, EMD Millipore Corp, USA, Cat. No. 17-10527), according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: Male Sst-Cre/tdTomato and Sst-Cre/tdTomato/Dnmt1 LoxP2 mice (13- to 17-week-old) underwent an intraperitoneal administration of pentylenetetrazole (PTZ, Sigma-Aldrich, U.S.A.) with 10 mg/kg living weight ...
-
bioRxiv - Genetics 2024Quote: ... The purified DNA product was released from the beads by incubating in 17 µL freshly made 10 mM Tris-HCl pH 8.0 (EMD Millipore, 648314-100mL) for 10 minutes ...
-
bioRxiv - Immunology 2023Quote: ... D2-glucose and 15N-glutamate as standards (Sigma-Aldrich). After centrifugation of the resulting homogenates ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were cultured in hypoxia and treated with 50µM 3-bromopyruvate (3-BP) (Sigma, 376817) dissolved in DMSO.
-
bioRxiv - Immunology 2021Quote: ... (3) TexMACS™ medium (Miltenyi) was supplemented with 3% heat-inactivated human AB serum (Sigma) and 1X Penicillin Streptomycin solution (TAC) ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Molecular Biology 2022Quote: ... home-made LIF conditioned medium and 2i inhibitors: 3 μM GSK-3 inhibitor XVI (Sigma) and 10 μM MEK inhibitor PD0325901 (Tocris)) ...
-
bioRxiv - Developmental Biology 2022Quote: Caspase 3 activity was measured using the Caspase-3 Colorimetric Activity Assay Kit (APT131, Millipore). Briefly ...
-
bioRxiv - Biophysics 2023Quote: ... we prepared a mixture containing 100mM 1-Ethyl-3-(3’-dimethylaminopropyl)carbodiimide HCL (8510070025, Sigma), and 200mM N-Hydroxysuccinimide (130672 ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were placed into 1/3 Methanol and 2/3 dichloromethane (DCM, Sigma-Aldrich, 270997) with rotation at 13rpm at room temperature for overnight incubation ...
-
bioRxiv - Microbiology 2024Quote: ... Isoprenol (3-methyl-3-buten-1-ol, 97% purity, 129402) was purchased from Sigma-Aldrich and added directly to the filtered M9 medium to specified concentrations as described in the text.
-
bioRxiv - Genomics 2024Quote: ... we performed gel passivation using 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC; Sigma-Aldrich #E7750) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 mins in phosphate-buffered saline (PBS) with 0.1% Tween-20 (both Sigma-Aldrich) and probed for 1 hour at room temperature in the dark with IRDye® 800CW conjugated goat anti-mouse secondary antibodies (LiCOR Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... shLmnA (produced in our lab), shLMNC (produced in our lab, 5′-TCTCCCACCTCCATGCCAAAG-3’) or shLMNB1 (Sigma clone NM_010721.1-956s1c1 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed and developed with chromogenic 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma-Aldrich, B6149).
-
bioRxiv - Physiology 2020Quote: ... and T3 (3,3’,5-triiodo-L-thyronine, > 95% HPCL, CAS number 6893-02-3, Sigma-Aldrich) were first dissolved in 0.1M NaOH and then diluted in 0.9% NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-5 μL of biliverdin hydrochloride (chromophore for iRFP signal activation, final concentration 0.002%, Sigma; 30891) added to cells and incubated for 10 mins at 37 °C before imaging ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Argentina).
-
bioRxiv - Neuroscience 2020Quote: ... Then washed for 5 min x 3 times and blocked in 1% BSA (A3059, Sigma-Aldrich) (w/v ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were washed 3×5 minutes in TBST buffer and incubated with ChAT antibody (Sigma, AB144) at 1:100 dilutions overnight at 4°C in the blocking buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were allowed to differentiate for 5 days with differentiating media [3 μg/ml prolactin (Sigma, #L6520 ...
-
bioRxiv - Cell Biology 2022Quote: ... The reagents treated for some indicated experiments include: 3-5 µM oligomycin A (Sigma, Cat# 75351), 1 µM (for HeLa cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 μM of the PKA activator 8-Bromoadenosine 3’,5’-cyclic monophosphate (Sigma, dissolved in water) and without FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AGTTTCTCTGTCCGATTTAAA-3’] are in the plasmid backbone pLKO.1-CMV-tGFP and were from Sigma Millipore (St Louis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed with PBS 3 times and blocked with 5% normal donkey serum (Sigma-Aldrich) in wash buffer for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified protein 5-HT2C or HCA2 (3 μg) was immobilized on nickel agarose beads (Sigma) in the incubation buffer containing 50 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... and guanosine-5’-γ-3-thiotriphosphate (GTPγS) were acquired from Sigma-Aldrich (St. Louis, MO, USA). WIN 55,212-2 was purchased from Tocris Bioscience (Bristol ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... and Mannitol (3 g of Bacto Peptone [Becton Dickinson], 5 g of Yeast Extract [Sigma-Aldrich] ...
-
bioRxiv - Bioengineering 2023Quote: ... All reaction mixtures contained 250 nM of sirtuin (SIRT1-3, 5 Reaction Biology, SIRT4,6,7 Sigma-Aldrich), 10 µM furimazine (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2024Quote: ... Parasites were maintained at <3% parasitemia and routinely synchronized by treating with 5% sorbitol solution (Sigma) for ring stage and by using percoll gradient (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Cell Biology 2024Quote: ... The proteins were eluted in buffer 5 [buffer 3 plus 200 μM FLAG peptide (Sigma-Aldrich)] for 1.25 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... 8-Br cAMP (8-Bromoadenosine 3′,5′-cyclic monophosphate, final conc. 500 µM; Sigma B6386-100mg). In addition to stimulation for decidualization ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Physiology 2024Quote: ... Samples were washed (3 times, 5 min each) with PBS containing 0.1% Triton X100 (Sigma-Aldrich), and then incubated with secondary antibody (Table 1 ...