Labshake search
Citations for Millipore Sigma :
1101 - 1150 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP; Sigma-Aldrich, Gillingham, UK) substrate solution (50 mg/ml BCIP in autoclaved water ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% Tween (Fisher)] containing either 5% non-fat milk powder or 3% BSA (Sigma-Aldrich) at room temperature for 40 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-5 kDa fluorescein isothiocyanate– dextran (FITC-dextran; 500 µg/ml, Sigma-Aldrich #FD4-100MG) was added to the culture media in the top channel ...
-
bioRxiv - Microbiology 2024Quote: Sulfamethoxazole (IUPAC: 4-Amino-N-(5-methylisoxazol-3-yl)-benzenesulfonamide) was purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following siRNAs were used in this study: siMis12C (Dharmacon siMIS12 5’-GACGUUGACUUUCUUUGAU-3’; Sigma siDSN1 5’-GUCUAUCAGUGUCGAUUUA-3’ ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.5% NP-40 (Sigma) in PBS for 5 min ...
-
bioRxiv - Biophysics 2024Quote: ... were activated for 5 min with a solution of 3-(Trimethoxysilyl)propyl methacrylate (Sigma-Aldrich, 440159 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 500 µg/ml N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (dbcAMP, Sigma). Cells were used for experiments up to passage 8 ...
-
bioRxiv - Neuroscience 2021Quote: A solution containing 10 μM of 5-bromo-2’-deoxyuridine (BrdU; SIGMA #858811) was added to the growth medium of SK-N-SH cell monolayers and cells were incubated at 37°C for 2 hours to estimate the S-phase index ...
-
bioRxiv - Biophysics 2020Quote: ... 10 mM NaN3 and 5 mM 2-deoxy-D-glucose (Sigma-Aldrich, Singapore).
-
bioRxiv - Cell Biology 2022Quote: ... (B-5-1-2 coupled to Alexa-488, Thermo Fisher or DM1A, Sigma), rat anti-tyrosinated tubulin (YL1/2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5-aza-2’-deoxycytidine was purchased from Sigma-Aldrich (Cat. A3656, Louis, USA).
-
bioRxiv - Cell Biology 2021Quote: ... mouse mAb anti-α-Tubulin (Sigma-Aldrich, clone B-5-1-2, #T5168); mouse mAb anti-Flag M2 (Sigma-Aldrich #F1804) ...
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal anti-alpha-tubulin clone B-5-1-2 antibody (T5168, Sigma-Aldrich) was used as the loading control ...
-
bioRxiv - Microbiology 2021Quote: ... hBMECs were subsequently incubated with 5 μM 4,6-diamidino-2-phenylindole (DAPI; Sigma) for 5 min at room temperature ...
-
bioRxiv - Physiology 2021Quote: ... the DNA methyltransferase inhibitor 5-aza-2 deoxycytidine was from Sigma-Aldrich (A3656), Polyethylenglycol 300 (PEG300 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the cysteine bonds reduced with 5 mM tris(2-carboxyethyl)phosphine (Sigma) (37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse α-Tubulin (Sigma, B-5-1-2, # T5168, used at 1:5000), mouse α-FLAG (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... slides were blocked with 5% normal donkey serum and 2% BSA (Sigma Aldrich) in PBS at room temperature for 1 h ...
-
bioRxiv - Neuroscience 2021Quote: ... media was changed to CM1 supplemented with 2-5 μg/mL puromycin (Sigma). On Day 3 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were incubated in medium containing 2μM 5-aza-2’-deoxycytidine (azadC; Sigma) for up to 6 days ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... polyps were incubated in 25 M 5-methoxy-2-methyl-indole (Sigma M15451) at 68°F for an hour (Fuchs et ...
-
bioRxiv - Immunology 2020Quote: ... or Pam2Cys + 2 mM 5-A-RU (Aubé laboratory) + 50 uM methylglyoxal (Sigma) in 200 uL on Day 0 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... followed by incubation with 400 μM 5-chloro-2′-deoxyuridine (CldU, Sigma-Aldrich) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... for 2 hours and stimulated with 5 μM nigericin (Sigma-Aldrich, Cat# N7143) or poly(dA:dT ...
-
bioRxiv - Bioengineering 2021Quote: ... 2-5 days before the analysis aggregates were gently dissociated using accutase (Sigma) and re-plated on coverslips coated with poly-L-ornithine (15μg/mL ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 5-Iodo-2-deoxyuridine (IdU) (Sigma Aldrich, cat# I7125, St. Louis, MO). BrdU was dissolved in sterile 0.9% saline and incubated at 55°C on dry heat block for 15 minutes to make 25mg/ml stock solution (Mandyam et al. ...
-
bioRxiv - Immunology 2022Quote: ... cells were treated with 2 mM sodium arsenite (Sigma-Aldrich, 7784-46-5) for 1 h and for inhibition of stress granule formation cells were treated with 1.5 µg/ml of ISRIB (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µg/mL 3,3’,5-triiodo-L-thyronine sodium salt (Sigma-Aldrich #T2752), 0.5 mg/mL superoxide dismutase (Sigma-Aldrich #S7571) ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 10 μM EdU and 1 μM 5-fluoro-2’-deoxyuridine (Sigma-Aldrich). Images were acquired with a DeltaVision Elite system and nuclear fluorescence signals quantified using custom software as described(10) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mice were injected with 1 mg 5’-bromo-2’-deoxyuridine (BrdU; Sigma #B9285). Following removal ...
-
bioRxiv - Molecular Biology 2024Quote: ... and monoclonal anti-α-tubulin antibody (clone B-5-1-2, Sigma-Aldrich). After incubation with primary antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... they were pulse-labeled with 50 µM 5- iodo-2’-deoxyuridine (IdU; Sigma) for 20 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with 2 mg/mL of fluorescein-5(6)-isothiocyanate (Sigma-Aldrich, Miss, USA). The samples were then incubated in the dark at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... difficile cultures were supplemented with 2-5 µg thiamphenicol ml-1 (Sigma-Aldrich) for plasmid selection ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µM 5-bromo-2′-deoxyuridine (BrdU, Sigma-Aldrich, St Louis, MO, USA) and 4 µM 5-fluoro-2′-deoxyuridine (FldU ...
-
bioRxiv - Molecular Biology 2023Quote: ... medium with 10% serum with 2 mM 5-Fluorouridine (FU; Sigma Aldrich, F5130) or directly attached on poly-D-lysine-coated coverslips ...
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were blocked with skim milk (5%) or 2% BSA (Sigma-Aldrich) for 1 hour and incubated with the corresponding primary antibodies for 2 hours at room temperature (RT ...
-
Early life lipid overload in Native American myopathy is phenocopied by stac3 knock out in zebrafishbioRxiv - Genetics 2023Quote: ... 5 mM K4Fe[CN]6,150 mM NaCl and 2 mM MgCl2 (Sigma-Aldrich) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... the mitotic marker 5-Bromo-2’-deoxyuridine (BrdU, 100 mg/kg; Sigma-Aldrich) was administered on the final day of CNO treatment ...
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-tubulin antibody (Sigma-Aldrich, Clone B-5-1-2). Horseradish peroxidase (HRP)-conjugated anti-rabbit (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-alpha Tubulin (clone B-5-1-2, Sigma-Aldrich, #T6074), rabbit polyclonal anti-GFP (Origene ...
-
bioRxiv - Neuroscience 2023Quote: ... that was brought to volume with 5% 2-hydroxypropoyl-β-cyclodextrin (Sigma-Aldrich) in water (Mediatech Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-5 µm slices were individually stained with Hematoxylin (Sigma #517-28-2), Picrosirius Red (Abcam #ab150681) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the media was supplemented with 10 μM 5’-fluoro-2’-deoxyuridine (Sigma-Aldrich) and 30 μM Uridine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α tubulin (T5168, B-5-1-2, Sigma-Aldrich, 1:1000). Rabbit anti-Solo antibody was purified using an immunogen peptide conjugated-Sepharose column from the antiserum ...
-
bioRxiv - Neuroscience 2024Quote: ... intraperitoneal injection of the thymidine analog 5- bromo-2-deoxiurydine (BrdU, Sigma Aldrich) diluted in NaCl 0.9% (10 mg/ml ...