Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 4’,6-diamidino-2- phenylindole (DAPI, Sigma, D9542) was diluted in the respective medium and added to the cultures at a final concentration of 10 ug/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... 4′,6-diamidino-2-phenylindole dihydrochloride (Sigma D8417). The sections processed for colorimetric immunohistochemistry were incubated with avidin-biotin-complex (Vector Laboratories PK-6100 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Sigma, D9542) was diluted in the respective medium and added to the fixed cells at a final concentration of 10 ug/mL ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Sigma- Aldrich) was used at 200 ng/ml for 15 minutes at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 2) directly fixed in 4% paraformaldehyde (Sigma-Aldrich) in 1x PBS and then stored in 1x PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 4) treated with 2 µM FCCP (Sigma-Aldrich), an uncoupler of the electron transport chain ...
-
bioRxiv - Biochemistry 2024Quote: ... supplemented with 4% 2-Mercaptoethanol (Sigma-Aldrich #M3148) to a final concentration of 1X LDS and heating at 95°C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... anti-rabbit Alexa Flour 488 and anti-rabbit Alexa Flour 546 5-(N-ethyl-N-isopropyl) amiloride (EIPA) and chlorpromazine hydrochloride (CPZ) were from Sigma-Aldrich (St. Louis, MO). EIPA was diluted to 10 mM with dimethylsulfoxide ...
-
bioRxiv - Developmental Biology 2024Quote: ... Tg(actab2:loxP-BFP-STOP-loxP-dsRed)sd27 fish were treated overnight at 5 dpf with 5 μM (Z)−4-Hydroxytamoxifen (4-OHT) (Sigma-Aldrich H7904) in EM ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Bioengineering 2024Quote: ... Phosphatase activity was determined by a chromogenic reaction using 5-bromo-4 chloro-3 indolyl phosphate and nitroblue tetrazolium (Sigma, St. Louis, MO, USA) as substrates.
-
bioRxiv - Bioengineering 2023Quote: ... Confluent monolayers were treated with 8-(4-chlorophenylthio)adenosine 3′,5′-cyclic monophosphate sodium salt (cPT-cAMP; Sigma-Aldrich, cat# C3912, 25-250 µM) Ro 20-1724 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... The reaction was visualized by subsequent addition of BCIP/5-bromo-4-chloro-3-indolylphosphate/nitro blue tetrazolium substrate (Sigma-Aldrich Cat#B5655-5TAB). The number of spots was determined using a CTL ImmunoSpot S5 UV Analyzer equipped with ImmunoSpot ImmunoCapture and ImmunoSpot Counting software (Cellular Technology Ltd. ...
-
bioRxiv - Immunology 2022Quote: ... 5 μM oligomycin and 100 mM 2-deoxyglucose (2-DG) (Sigma-Aldrich) were injected to each well after 18 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... Aprotinin (1:5, 4 TIU/ml; Sigma-Aldrich, UK) was added to all blood samples ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hrs and 5 mM ATP (Sigma, A26209) for different periods up to 4 hours.
-
bioRxiv - Genomics 2022Quote: ... 4 mL of 5 mM IBMX (Sigma, #I-5879), 1 ng/mL Heparin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 % Span80 (Fluka) surfactant and 4 % 2-Hydroxy-2-methylpropiophenone (97%, Sigma-Aldrich) photoinitiator ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissues were next transferred into 500 µl of ethyl cinnamate (Sigma) in Eppendorf tubes (Polypropylene ...
-
bioRxiv - Biophysics 2021Quote: ... N-ethyl-maleimide (NEM) was from Sigma-Aldrich (St. Louis, MO) dissolved in methanol and stored as aliquots at −20 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Ethyl cellulose (99% purity, 100 cP) was purchased from Sigma Aldrich. Fluorescein (free acid ...
-
bioRxiv - Genetics 2022Quote: ... and 10 mM N-ethyl maleimide (Sigma, St. Louis, MO, USA). Samples were vigorously vortexed and frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... and maintained with urethane (1.3 g/kg, i.p.; ethyl carbamate, Sigma), and supplemental doses of ketamine (30 mg/kg ...
-
bioRxiv - Genetics 2022Quote: ... L4 larvae were exposed to 0.15% ethyl methane sulfonate (EMS, Sigma) in M9 buffer for 4h at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... L4 larvae were exposed to 0,3% ethyl methane sulfonate (EMS, Sigma) in M9 buffer for 4 h at room temperature ...
-
bioRxiv - Immunology 2020Quote: After anesthesia with 0.02% aminobenzoic acid ethyl ester (tricaine, Sigma-Aldrich), 28 hours post fertilization (hpf ...
-
bioRxiv - Plant Biology 2023Quote: ... were incubated with 8 ml of 0.74 % ethyl methanesulfonate (EMS, Sigma) in 0.1 M NaH2PO4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos were cleared with ethyl cinnamate (ECi; cat#112372, Sigma) according to a previous protocol (Klingberg et al. ...
-
bioRxiv - Microbiology 2022Quote: ... ethyl-isopropyl amiloride (EIPA) and cresyl violet were from Sigma-Aldrich; YM201636 and latrunculin A were from Cayman Chemicals ...
-
bioRxiv - Neuroscience 2022Quote: ... An initial concentration of Ethyl Cellulose (EC) (EC 200646, Sigma Aldrich) at 2.5 wt% and 10 mg/mL graphene powder were then added in 10 mL C/T and DMF ...
-
bioRxiv - Developmental Biology 2024Quote: The GR2123 strain was mutagenized with ethyl methanesulfonate (M0880, Sigma-Aldrich) exactly as previously described (Dowen et al. ...
-
bioRxiv - Cancer Biology 2024Quote: Mice were treated with Di-ethyl-nitrosamine (DEN, Sigma-Aldrich; N0756) at 40 mg per litre in Ribena- flavoured water for 24-hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... tetramethylrhodamine ethyl ester perchlorate (TMRE; Sigma Aldrich, cat. no. 87917-25MG). HFFs were infected with IF1Ty ...
-
bioRxiv - Microbiology 2022Quote: ... were place on the plate and 10 μL of (1, 2, 4 and 9.8 M) H2O2 and (2, 4, 6 M) methyl viologen (Sigma-Aldrich, UK) was dispensed onto each separate disk ...
-
bioRxiv - Neuroscience 2024Quote: ... Those reduced thiols were then labelled with 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin (CPM; Sigma Aldrich) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Bioengineering 2022Quote: 4-Nitrophenyl β-D-glucuronide (4-NPG, CAS no. 10344-94-2) (Sigma-aldrich) was prepared in 50 mM sodium phosphate buffer (Na-PB ...