Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 10000+ citations for 2 3 Dimethyl 3' 4 methylpiperazinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’-GATCCCCAAATCT-3’ and 5’-GATCAGAT[BtndT]TGGG-3’ with 5’ end phosphate (Sigma-Aldrich), were annealed (81 µl of each Oligo 100 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’-GATCCCCAAATCT-3’ and 5’-GATCAGAT[BtndT]TGGG-3’ with 5’ end phosphate (Sigma-Aldrich), were annealed (81 µl of each Oligo 100 µM ...
-
bioRxiv - Microbiology 2024Quote: ... Isoprenol (3-methyl-3-buten-1-ol, 97% purity, 129402) was purchased from Sigma-Aldrich and added directly to the filtered M9 medium to specified concentrations as described in the text.
-
bioRxiv - Genomics 2024Quote: ... we performed gel passivation using 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC; Sigma-Aldrich #E7750) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Biochemistry 2020Quote: ... Day 1 adult animals were mounted on 2% (vol/vol) agar pads and immobilized with 30 mg/mL 2-3-butaneione monoxime (BDM, Sigma) in M9 buffer.
-
bioRxiv - Biochemistry 2020Quote: ... animals were mounted on 2% (vol/vol) agar pads and immobilized in 30 mg/mL 2-3-butaneione monoxime (BDM, Sigma) in M9 buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... E10.5 embryos were incubated in 4-nitro blue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Sigma, 5655-25TAB) except when detecting Six1 and Mcrs1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... dimethyl-α-ketoglutarate (Sigma), adenine (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... dimethyl amiloride (Sigma, A125), heparin (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... dimethyl sulfate (DMS, Sigma) was added to the medium at concentrations of 6 or 24 mM ...
-
bioRxiv - Cell Biology 2021Quote: ... Dimethyl malonate (Sigma 136441), Harzianopyridone (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... Dimethyl itaconate (Sigma, 592498), Dimethyl malonate (Sigma 136441) ...
-
bioRxiv - Cell Biology 2024Quote: ... or dimethyl sulfoxide (Sigma) for controls ...
-
bioRxiv - Microbiology 2024Quote: ... Dimethyl sulfoxide (Sigma-Aldrich) was used as a diluent for the pan-caspase inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... dimethyl sulfoxide/DMSO (Sigma), paclitaxel (Calbiochem) ...
-
bioRxiv - Neuroscience 2022Quote: ... Dimethyl sulfoxide (Sigma-Aldrich) or drugs at the concentrations indicated (dissolved in dimethyl sulfoxide ...
-
bioRxiv - Genomics 2023Quote: ... 50 % dimethyl sulfoxide (Sigma) and 10 mM iodoacetamide (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... dimethyl sulfoxide (DMSO, Sigma), sodium acrylate (Sigma) ...
-
bioRxiv - Cell Biology 2024Quote: ... Dimethyl sulfoxide (DMSO) (Sigma) was introduced to cells before plating on collagen coated glass substrates.
-
bioRxiv - Microbiology 2020Quote: ... control unstained erythrocytes were incubated with 2 µl of Dimethyl-sulphoxide (DMSO; Sigma Aldrich). After 2 hours of incubation at 37°C while shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... magnesium acetate (2 mM) and was chemically modified with dimethyl sulfate (DMS, Sigma Aldrich) (0.7% v/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... CF555-NHS (5 µL, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNPs (500 µL) ...
-
bioRxiv - Developmental Biology 2021Quote: Zona pellucida were removed from embryos with 3-4 min pronase (0.5% w/v Proteinase K, Sigma P8811 ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated for 3 days at 4°C with rabbit anti-AVP (1:2,000, Sigma, PC234L) or rabbit anti-Ntng1 (1:1,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... mounted on slide glass or coverslips and postfixed with 4% PFA in PB or 3% glyoxal (Sigma) for 2 h at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were passaged at 1/8 ratio every 3 or 4 days with Accumax (Millipore, ref. SCR006).
-
bioRxiv - Bioengineering 2021Quote: ... scaffolds (n = 3) were submerged into 500 μL of 4 M guanidine hydrochloride (GuHCl, Sigma-Aldrich, Canada) buffer supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Bioengineering 2021Quote: ... 48 h and day 21 hBMMSC-seeded scaffolds (n=3) were fixed in 4% paraformaldehyde (Sigma, Canada) for 1 hour and submerged in gradient sucrose solutions from 10% to 30% ...
-
bioRxiv - Zoology 2021Quote: 200 mg Et-IPA (a-Ethyl-3-hydroxy-2,4,6-triiodohydrocinnamic acid, CAS 96-84-4, Sigma Aldrich) was dissolved in 4 ml edible corn oil ...
-
bioRxiv - Cancer Biology 2020Quote: ... wells were washed three times as quickly as possible with ice-cold blood bank saline and lysed on the dish with 700μL of (4:3) methanol:0.88% KCl in water with 0.25μg/mL tridecanoic acid (Sigma, T0502) to use as an internal extraction standard ...
-
bioRxiv - Bioengineering 2022Quote: ... ADC scaffolds (n = 3) were gently agitated in 4 M guanidine hydrochloride buffer (GuHCl, Sigma-Aldrich, Canada) supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were incubated overnight at 4 °C in PBST containing 3% bovine serum albumin (BSA) (Sigma Aldrich) and primary antibodies ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were passaged at 80% confluence (approximately every 3-4 days) in T75 flasks (Millipore-Sigma, Z707546) using 0.25% Trypsin-EDTA (ThermoFisher 25200072 ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were passaged at 80% confluence (approximately every 3-4 days) in T75 flasks (Millipore-Sigma, Z707546) using 0.25% Trypsin-EDTA (ThermoFisher 25200072 ...
-
bioRxiv - Plant Biology 2021Quote: ... 600 μl 4% acetic acid with 20 μl 1mM phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX, Sigma) and 0.6 μl 1mM spike control 8-Br-2′,3′-cAMP (Biolog ...
-
bioRxiv - Bioengineering 2023Quote: ... A second solution was prepared with 80 milligrams of 3-(4-hydroxyphenyl) propanoic acid (HPA; Sigma Aldrich), 80 milligrams EDC ...
-
bioRxiv - Biochemistry 2024Quote: ... Incubation with the 4-MU substrate (3 mM in citrate phosphate buffer with 0.2% taurodeoxycholate, Sigma-Aldrich) for 90 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... were thawed at room temperature for 3-4 minutes in Nuclei EZ lysis buffer (Sigma Nuc 101) mixed with RNAase inhibitor (0.5U/µl ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Microbiology 2022Quote: ... XTT (sodium 3′- [1- (phenylaminocarbonyl)- 3,4-tetrazolium]-bis (4- methoxy6-nitro) benzene sulfonic acid hydrate) (Sigma-Aldrich), according to the manufacturer’s recommended specifications ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were eluted by 3-4 incubations in 200-500 μg/mL 3X FLAG peptide (Sigma F4799) in Low-detergent Membrane IP Wash buffer in 600-900 μL final volume ...
-
bioRxiv - Neuroscience 2024Quote: ... Zebrafish larvae at 4 dpf were anaesthetised using 0.016 % ethyl 3-aminobenzoate methane sulfonate (MS-222, Sigma). They were then mounted in 1% low melting point agarose (LMP ...
-
bioRxiv - Biochemistry 2024Quote: ... Final protein preparation was concentrated using a centrifugal filter unit (Amicon Ultra-4, 3 kDa cutoff, Millipore) at 3500 g ...
-
bioRxiv - Immunology 2022Quote: Itaconate (ITA) and its derivatives 4-octyl itaconate (4-OI) and Dimethyl itaconate (DMI) were purchased from Sigma-Aldrich (Deisenhofen, Germany) (ITA ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)