Labshake search
Citations for Millipore Sigma :
9551 - 9600 of 10000+ citations for Rabbit Anti Human IgG+IgM+IgA Alexa Fluor 660 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Pathology 2021Quote: ... Cytokine profiling analysis was performed by Eve Technologies (Calgary, AB Canada) using the Milliplex MAP Human Cytokine/Chemokine Panel (Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Immunology 2021Quote: Primary human monocytes were isolated from buffy coats from healthy blood donors by density gradient centrifugation (Histopaque™, Sigma-Aldrich). For studies of monocytes and M1/M2-type macrophages ...
-
bioRxiv - Pathology 2019Quote: Seven-µm-thick sections of human or murine atrial samples were stained with PicroSirius red according to manufacturer’s instructions (Sigma-aldrich). Bright images were acquired with a Nikon DS-Ri1 camera coupled to Eclipse-Ti Nikon microscope and Nis-Element software (Nikon France S.A. ...
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Biochemistry 2019Quote: ... STAT1 (0.3 µM) (Biosource, PHF0011) was phosphorylated in vitro by incubation with recombinant human cdk1/cyclinB (0.2 µM) (Millipore, 14-450) at 30 °C for 90 min in the presence of 1 mM ATP ...
-
bioRxiv - Biochemistry 2020Quote: ... Non-glycosylated OCN or glycosylated OCN was incubated at 50ng/ml in the diluted plasma for two hours in the presence of different concentration of human plasmin (Sigma) ranging from 0 to 0.3U/ml ...
-
bioRxiv - Systems Biology 2020Quote: Human embyronic kidney cells (HEK-293 cells) were grown as adherent cultures in DMEM with high glucose (Sigma-Aldrich D5796), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: Madin-Darby canine kidney (MDCK) and human embryonic kidney 293T (293T) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Sigma-Aldrich) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2020Quote: The human multiple myeloma cell line (MMCLs) MM.1S (ATCC, Manassas, VA, USA) was cultured in RPMI1640 media (Sigma, UK) and 20% FBS (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Metaphase II-arrested oocytes tightly packed with cumulus cells were collected from the oviductal ampulla 14 h after hCG injection and placed in a 100-μl drop of human tubal fluid (HTF; Millipore) medium covered with mineral oil ...
-
bioRxiv - Cell Biology 2020Quote: ... A2780 human ovarian cancer cells (female) stably expressing Rab25 (Caswell et al., 2007) were maintained in RPMI-1640 medium (Sigma) supplemented with 10 % FCS ...
-
bioRxiv - Genetics 2021Quote: ... were superovulated by serial Pregnant Mare Serum Gonadotropin (5 IU per mouse, Prospec Protein Specialists) and human chorionic gonadotropin (5 IU, Millipore) injections 46 h apart ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated 30 seconds in plasma cleaner then coated with cell-specific adhesive surface: for at least 1 hour with 10 μg/ml recombinant human fibronectin (Sigma) for Hela and SHSy-5Y cells ...
-
bioRxiv - Immunology 2020Quote: ... Freshly-isolated neutrophils were suspended at 106 or 5×106 cells/mL in RPMI media (containing 10% human AB serum (Sigma)) and incubated at 37°C and 5% CO2 for up to 18h ...
-
bioRxiv - Microbiology 2020Quote: Human HeLa229 cells (ATCC CCL-2.1tm) and human epithelial conjunctival cells (Chang) were cultured in 10 % (v/v) heat inactivated FBS (Sigma-Aldrich) RPMI1640 + GlutaMAXtm medium (Gibcotm ...
-
bioRxiv - Immunology 2020Quote: ... mononuclear cells were thawed and plated at 106 cells per cm2 in 20 ml RAB5 (RPMI with 5% human serum AB (Sigma), 2 mM L-alanyl-L-glutamine ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma, supplemented with 27mM sodium biocarbonate ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: ... and PBS-treated (n ≥ 3) control human gut xenografts and mouse jejunum were purified using GenElute Mammalian Total RNA kit (Sigma) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from human hippocampal and prefrontal cortex tissue and mouse hippocampal tissue was extracted with TRIzol reagent (Sigma-Aldrich) and 1 μg was reverse-transcribed using PrimeScriptTM RT Reagent Kit (perfect Real Time ...
-
bioRxiv - Neuroscience 2020Quote: ... SI and protein extracts from human and mouse samples were resolved in SDS-PAGE transferred to Immobilon-P PVDF membranes (Millipore). Membranes were activated with methanol and blocked with 4 % bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2022Quote: ... The slides containing hamster and human lung tissue sections were deparaffinized in xylene (Sigma-Aldrich Inc., MO, USA; catalog# 534056) and rehydrated in graded alcohols to water ...
-
bioRxiv - Bioengineering 2022Quote: ... Tumor Necrosis factor alpha (TNF-α)) was carried out with Human Cytokine/Chemokine Magnetic Bead Panel (MilliPlex MAP, Millipore, Sigma). Median fluorescence intensity of each analyte was read using a MAGPIX system (Luminex) ...
-
bioRxiv - Bioengineering 2022Quote: ... Tumor Necrosis factor alpha (TNF-α)) was carried out with Human Cytokine/Chemokine Magnetic Bead Panel (MilliPlex MAP, Millipore, Sigma). Median fluorescence intensity of each analyte was read using a MAGPIX system (Luminex) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and subcultured for 72 h in NK MACS medium supplemented with 5% human serum male AB plasma (#H4522, Sigma-Aldrich) and human IL-2 IS (200 IU/ml ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were counted and further diluted at the required concentration for the following procedures in RPMI 1640 containing 10mM HEPES (Roth) and 0.5% human serum albumin (Sigma Aldrich). Purity of the isolation was assessed by a cytospin assay (Cytospin 2 Zentrifuge ...
-
bioRxiv - Cell Biology 2022Quote: Human monocyte-derived macrophages were separated from healthy donor buffy coats by centrifugation through Histopaque 1077 (Sigma-Aldrich, Cat # H8889) gradient ...
-
bioRxiv - Immunology 2022Quote: ... Antibody production was conducted by co-transfection of the heavy and light chain expression vectors into Human HEK293 suspension culture cells (Expi293F) using polyethylene mine (Sigma). Cells were subsequently cultured for 4 days before being pelleted by centrifugation ...
-
bioRxiv - Microbiology 2022Quote: Total protein was extracted from LT toxin-treated (100ng/ml) human differentiated enteroid monolayers (235D line) and untreated control using radioimmunoprecipitation assay (RIPA) buffer (Sigma) containing protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Immunology 2022Quote: ... expanded in the presence of recombinant human IL-2 (1000 U/mL, Proleukin) and rapamycin (50 nmol/L, Sigma-Aldrich), and transduced after 2 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... PDAC cells were treated with human recombinant FasL (MiaPaCa2: 50 ng/mL; TKCC10: 100 ng/mL) (Sigma-Aldrich, cat. SRP3036), 48 hours post transfection ...
-
bioRxiv - Microbiology 2024Quote: ... Cytokines secreted by primary CF-HBECs were analyzed by the MILLIPLEX MAP Human Cytokine/Chemokine 48-Plex cytokine assay (Millipore). Cytokines were measure in the basolateral solution only since CF-HBEC were grown in air-liquid interface culture and there was insufficient apical fluid to measure cytokines.
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of mouse TRAIL (aa118-291) or human TRAIL (aa115-281) was amplified from its cDNA and was cloned into pET21b (Novagen) using NdeI and XhoI sites ...
-
bioRxiv - Bioengineering 2024Quote: ... Tumor Necrosis factor alpha (TNF-α)) was carried out with human cytokine/chemokine magnetic bead panel (MilliPlex MAP, Millipore, Sigma). Median fluorescence intensity (MFI ...
-
bioRxiv - Bioengineering 2024Quote: ... Tumor Necrosis factor alpha (TNF-α)) was carried out with human cytokine/chemokine magnetic bead panel (MilliPlex MAP, Millipore, Sigma). Median fluorescence intensity (MFI ...
-
bioRxiv - Molecular Biology 2024Quote: ... and human epithelial type 2 (HEp-2, CCL-23, ATCC) cells were cultured in Dulbecco’s modified eagle medium (DMEM, Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: CM was collected from TIS MDA-MB-231 cells for chemokine and cytokine analyses using a Milliplex MAP human cytokine/chemokine magnetic bead panel (Merck Millipore) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... the HepG2 human hepatocyte carcinoma cell line and the HT29 human colon adenocarcinoma cell lines were purchased from the European Collection of Authenticated Cell Cultures (ECACC) through their distributor (Sigma). The HL1 cell line was purchased from Millipore ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Supplemented IVM media for OSC-IVM consisted of IVM media (Medicult, Origio) supplemented with 75 mIU/ml of recombinant human FSH (Millipore), 100 mIU/ml recombinant human chorionic gonadotropin (hCG ...
-
bioRxiv - Molecular Biology 2024Quote: ... Follicles were then cultured in αMEM-based maturation media supplemented with 10% FBS and 1.5 IU/mL Human chorionic gonadotropin (hCG, Sigma-Aldrich) in a an incubator (37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Rescue experiments were performed by supplementing the medium with either 25 µg/mL human plasma fibronectin (Millipore Sigma; Catalogue #FC010) or with 10 ng/mL of human TGFβ1 (Peprotech ...
-
bioRxiv - Immunology 2024Quote: ... Antibody for β-actin (Catalog no. A2228) and human α-thrombin (Catalog no. T6884-100N) was purchased from Sigma-Aldrich. All other reagents were bought from Fisher-Scientific except where noted.
-
bioRxiv - Cell Biology 2023Quote: ... gondii RH ΔKU80Δhxgprt AtTIR1 and RH TatiΔKU80 strains were grown in Human Foreskin Fibroblasts (HFF) (ATCC, SCRC-1041) in DMEM media (Millipore Sigma) supplemented with 10% FBS [56 ...
-
bioRxiv - Immunology 2023Quote: ... EasySep™ Human NK Cell Isolation Kit) and were frozen down in CS10 CryoStor cell cryopreservation media media (Sigma-Aldrich).
-
bioRxiv - Microbiology 2023Quote: ... a spectrophotometric stop reaction was used to calculate the activity of human salivary α-amylase (Sigma-Aldrich, cat. No. 1031) using Equation 1 (b = intercept of linear regression ...
-
bioRxiv - Synthetic Biology 2023Quote: Stable cell lines expressing human or mouse PRLR were generated by lentiviral transduction followed by 0.7 ug/mL puromycin selection (Sigma; P9620). 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Four- to five-week-old C57Bl/6 females were superovulated and MII oocytes collected in fertilisation media (Human Tubal Fluid (HTF, MR-070, Sigma) containing 4 mg/ml BSA and 25mM L-Glutathione 1 (GSH)) ...