Labshake search
Citations for Millipore Sigma :
9001 - 9050 of 10000+ citations for Cow Fructose 1 6 Bisphosphatase 2 FBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 50,000 MBS-MEFs were seeded in 6-well plates and exposed to the virus particles mentioned above in serum-free media supplemented with 6 µg/ml polybrene (Sigma). Cells with high or low expression of tdTomato were selected by FACS (BD Biosciences Aria III).
-
bioRxiv - Biophysics 2022Quote: ... in this work referred to as Pif1) fused at its N-terminus to a 6-histidine tag was cloned into vector pET28 (Novagen) and transformed into E ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were grown to near confluency on 6 cm dishes and total RNA was extracted using the RNAzol RT reagent (Sigma) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged 1800 rpm for 6 minutes at 4°C and pellets were resuspended n 3 mL RBC lysis for 4 minutes (Sigma). Samples were centrifuged 1800 rpm for 6 minutes at 4°C and the pellets were resuspended in 200 μl of PBS + 2% FBS + 2 mM EDTA ...
-
bioRxiv - Microbiology 2022Quote: ... Excision of the GFP cassette in blood stage parasites was monitored by flow cytometry using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore) to detect GFP and mCherry ...
-
bioRxiv - Microbiology 2022Quote: MDCK-SIAT1 cells were infected with the PR8 NP:WT/F346S viruses at an MOI of 5 TCID50/cell in a 6 well plate in the presence of 100µg/mL of cycloheximide (Sigma-Aldrich). Infected cells were harvested at 2 and 6hrs post-infection ...
-
bioRxiv - Biochemistry 2022Quote: ... were separated on 0.1% SDS polyacrylamide gels (6–12% w/v depending on the molecular mass of protein) and electroblotted onto Immobilon-PVDF Transfer Membrane (Merck Millipore). Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 g/L (days 0-5 and days 11-14) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM ascorbic acid (days 3-10) ...
-
bioRxiv - Neuroscience 2021Quote: ... one day after the apomorphine-induced rotation test the rats were administered daily 6 mg/kg L-DOPA (Sigma Aldrich) and 15 mg/kg benserazide HCl (purchased from the Chinese domestic market) ...
-
bioRxiv - Biochemistry 2021Quote: ... from Arthrobacter ureafaciens (cat # 10269611001) and α2-6-sialyltransferase from Photobacterium damsela (Pd2-6ST, cat # S2076) were purchased from Sigma. CMP-Neu5Ac (cat # 233264 ...
-
bioRxiv - Neuroscience 2022Quote: ... HeLa cells were rinsed with PBS and cultured in the normal culture medium supplemented with 100 μM 6-aminonicotinamide (Sigma) (6AN ...
-
bioRxiv - Neuroscience 2022Quote: ... and four old (24-month old) male C57BL/6 mice were deeply anesthetized and perfused with cold PBS (Sigma, D8537). Each brain was carefully removed and individually micro-dissected under a dissection microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 μL of beads were washed with PBS and incubated with 6 μg of anti-FLAG antibody (Sigma-Aldrich, F1804) in PBS + 0.5% BSA at 4°C for 3 h with gentle rocking ...
-
bioRxiv - Microbiology 2022Quote: ... cells were replated in 6-well plates with RPMI medium containing 1mg/mL G-418 (Sigma-Aldrich, St. Louis, MO). As we described previously (52) ...
-
bioRxiv - Physiology 2022Quote: ... virgin female flies were collected within 6 h of eclosion and reared on standard medium supplemented with 1.5 mM methoprene (Sigma-Aldrich, St Louis ...
-
bioRxiv - Microbiology 2022Quote: A CRISPR array containing 6 identical spacers targeting the tetR gene flanked by 7 repeats was cloned into pCDF-Duet (Novagen, Merck Millipore) by ligation after NcoI and SalI digestion ...
-
bioRxiv - Bioengineering 2019Quote: Substrates were placed into 6-well plates and both chambers were washed three times with 50 mM HEPES pH 8.5 (Sigma H3375). The polyacrylamide was activated for ECM protein coating by covering the substrates with 500 μL of 0.5 mg/mL sulfo-SANPAH (Proteochem c1111 ...
-
bioRxiv - Plant Biology 2019Quote: ... ten first or second leaves from independent plants were harvested at the indicated time points and transferred to a 15 ml tube containing 6 ml water purified using a Milli-Q integral 5 water purification system (Millipore). After a 6 h-incubation at room temperature on a horizontal shaker ...
-
bioRxiv - Cancer Biology 2019Quote: ... 25 μl Ad5CMVFlpO (6 × 1010 PFU/ml) was incubated with 600 μl minimum essential media (Sigma-Aldrich, St Louis, MO) and 3 μl 2 M CaCl2 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... The sample was then cut in half with a clean razor and each piece was placed in a 6-well plate with 10 ml of ASW and lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (Sigma) at a final concentration of μg/ml (or an equal volume of sterile diH2O ...
-
bioRxiv - Molecular Biology 2019Quote: ... U2OS cells were seeded in a 6-well plate and infected with lentivirus supernatant in the presence of 5 μg/mL polybrene (Sigma). Medium was replaced by fresh media with 10 μg/mL Blasticidin S at 24 hours post-infection ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6) was from Sigma-Aldrich. The stock solutions of the enzyme inhibitors and fluorogenic substrates were prepared according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting adhered bacteria on the cover slip were stained with 200 μL of the membrane stain N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) (Sigma) at a final concentration of 20 μg/mL for 5 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Next the slides were mounted with a coverslip using Mowiol (6 g glycerol, 2.4 gr polyvinylalcohol 4-88 (Sigma, 81381), 6 ml MQ and 12 ml 0.2 M Tris HCL pH 8.5).
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Labeled lentivirus particles were then purified to eliminate excess free dyes and lipids by ultracentrifugation for one hour at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient ...
-
bioRxiv - Synthetic Biology 2020Quote: ... glass coverslips placed in 6-well plates were coated in a 0.1 mg/mL solution of poly-L-lysine hydrobromide (Sigma #P6282) for 5 min and left to dry overnight before plating 6×105 cells per well in 2 mL DMEM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells were transiently transfected with plasmids in 6-well plates and 24 hours post-starvation were incubated with 100μg/ml of cycloheximide (Sigma #4859) for indicated time points ...
-
bioRxiv - Pathology 2021Quote: ... rats in the high-dose 7-d L-DOPA priming group (n=6) were treated daily with L-DOPA (12 mg/kg) + benserazide (15 mg/kg, s.c., Sigma-Aldrich) for 7 d (i.e. ...
-
bioRxiv - Cell Biology 2019Quote: ... and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore, Tullagreen Carrigtwohill Co.Cork ...
-
bioRxiv - Biophysics 2019Quote: ... as a Tobacco Etch Virus (TEV)-cleavable N-terminal His-tagged (6×-His) fusion protein using a pET46 Ek/LIC vector (Novagen) and purified using Ni-NTA affinity chromatography and gel filtration chromatography as previously described (Hughes et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was fused with an N-terminal His(6)-tag followed by maltose binding protein (MBP) tag and TEV cleavage site in pET21 vector (Novagen).
-
bioRxiv - Cancer Biology 2019Quote: ... RIPK3 inhibitor GSK 872 (N-(6-(Isopropylsulfonyl)quinolin-4-yl)benzo[d]thiazol-5-amine) was purchased from Millipore Sigma and frozen stocks were maintained in DMSO ...
-
bioRxiv - Neuroscience 2019Quote: hNSG and non-engrafted NSG mice (4-6 months old) were injected 3 mg/kg (i.p.) with lipopolysaccharide (LPS from E. coli; O55:B5, Sigma-Aldrich) or 0.9% saline solution ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was resuspended in 6 ml ice-cold G-buffer containing 5 µg/ml TLCK-treated chymotrypsin (Sigma, #C3142) and incubated overnight at 4°C ...
-
bioRxiv - Physiology 2020Quote: ... rubens (< 6 cm diameter) were fixed by immersion in seawater Bouin’s fluid [75% saturated picric acid (Sigma-Aldrich, Gillingham, UK) in seawater ...
-
bioRxiv - Microbiology 2021Quote: ... in 6 well plates were transfected with HSIV-vif plasmids using Fugene 6 or X-tremeGENE 9 DNA transfection reagent (Roche/Sigma). At 48 hour post-transfection ...
-
bioRxiv - Physiology 2021Quote: ... 6 × 105 cells were seeded on 6-well multiwell plates and counted every two days from day 4 to day 14 using Trypan blue (Sigma) and a Neubauer chamber.
-
bioRxiv - Cell Biology 2022Quote: ... two shRNA targeting exon 5 and exon 6 were synthesized along with a control shRNA targeting the luciferase gene as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats ...
-
bioRxiv - Developmental Biology 2021Quote: ... inactivated with 10 µg/ml mitomycin C and seeded at 4 × 105 per 6 cm dish) in DMEM/F12/KSR medium (D-MEM/F12 (Sigma) supplemented with 20% KSR additive ...
-
bioRxiv - Cell Biology 2020Quote: ... electroporated parasites were mixed immediately with 100 μl of reticulocyte-rich blood from a naïve mouse treated with phenylhydrazine (6 mg/ml) (Sigma-Aldrich), incubated at 37°C for 20 min and then injected intraperitoneally into another mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... or control non-target shRNAs were induced to differentiate for 6 days and RNA was extracted with Tri-Reagent (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µg of RNA were separated on MEN-buffered 1.5% agarose gels that provided denaturing conditions by 6% formaldehyde using an RNA sample loading buffer containing a final concentration of 62.5% (v/v) deionized formamide (Sigma-Aldrich). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... The enzyme reaction was started by the addition of 0.16 ml of 6 mM p- nitrophenyl β-D-glucuronide (Sigma) to the broken cells and stopped by the addition of 0.4 ml of 1.0 M NaCO3 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then analyzed on a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Microbiology 2020Quote: ... Cells were then fixed with 1% formaldehyde solution and analyzed using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Immunology 2021Quote: ... were characterized and fractionated by size exclusion chromatography using a Superose 6 10/300 GL on an AKTA liquid chromatography system and concentrated on AmiconUltra 100k spin columns (Millipore).