Labshake search
Citations for Millipore Sigma :
851 - 900 of 10000+ citations for 1 2 Chloropyridin 3 yl 3 3 dimethylazetidin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 150 μl 1-Bromo-3-chloropropane (Sigma-Aldrich) was added to the RNAsolv ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 μM 3-isobutyl-1-methyxanthine (Sigma Aldrich), 1μM pioglitazone (provided by AZ) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Millipore Sigma), and 1 µg/ml insulin (Millipore Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-isobutyl-1-methylxanthine (IBMX, 0.5mM, Sigma Aldrich), and dexamethasone (1μM ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CGRP (Sigma, #PC205L, 1:800, 3 days), anti-β-III tubulin (Cell Signaling ...
-
bioRxiv - Physiology 2022Quote: ... 3-isobutyl-1-methylxantine (IBMX, Sigma, cat# 17018), isoproterenol hydrochloride (Tocris Bioscience ...
-
bioRxiv - Biophysics 2024Quote: ... a 3:1 BrdU/BrdC mix (Sigma-Aldrich, #B5002 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 µg/ml laminin (all 3 Sigma, USA). During terminal differentiation ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% phosphatase inhibitor cocktail 3 (Sigma-Aldrich P0044), 1X PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-IBA4 (Sigma, #L2140, 1:800, 3 days), anti-CGRP (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-NEUN (Fox-3; Millipore ABN91; 1:500), anti-C1Q (Abcam ab182451 ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µg mL-1 aphidicolin (Sigma Aldrich, A0781) was added to the cells to arrest them at the G1/S boundary ...
-
bioRxiv - Neuroscience 2024Quote: ... 3% Triton-X-100 (Sigma 9002-93-1) and then incubated overnight with anti-cFos antibody (1:400 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 150 μl 1-Bromo-3-chloropropane (Sigma Aldrich) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1-Bromo-3-chloropropane (Sigma-Aldrich # B9673) extraction ...
-
bioRxiv - Neuroscience 2024Quote: ... 3) anti-collagen IV (1/250) (Millipore, AB769), 4 ...
-
bioRxiv - Biochemistry 2024Quote: ... 150 μl 1-Bromo-3- chloropropane (Sigma-Aldrich) was used to induce phase separation the washed RNA pellet was dissolved in 20 μl RNase-free water by incubating for 10 min on a shaking 65 °C heat block.
-
bioRxiv - Microbiology 2024Quote: ... recombinase expression was induced with 1 mM 3-methyl-benzoate (Sigma Aldrich T36609; m-toluic acid; “3-MB”), and cultures were allowed to resume growth overnight before being used in the tolerization experiment (as described earlier) ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Then the supernatant was separated by size to a large (>3 kDa) and small (<3 kDa) fraction using Amicon ultrafiltration system with 3 kDa filter (Millipore, Ireland). The fraction then filtered again through a 0.22 µm (Millipore).
-
bioRxiv - Biochemistry 2023Quote: ... N-(3-Oxoocatnoyl)-L-HSL (>97%) (3-Oxo-C8) and N-(3-Oxododecanoyl)-L-HSL (>98%) (3-oxo-C12) were used as received from Sigma-Aldrich. N-(3-Hydroxy-7-cis-tetradecanoyl)-L-HSL (>95% ...
-
bioRxiv - Neuroscience 2024Quote: ... antibodies were diluted in a 3% BSA in PBS and either 3% normal goat serum or 3% normal donkey serum (Millipore-Sigma) depending on the secondary antibody host species ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Zoology 2020Quote: ... 3-methyl-but-2-enyl acetate and (2E)-hex-2-enyl acetate were confirmed with analytical standards from Sigma-Aldrich (St. Louis, MO). For the analysis of CHCs ...
-
bioRxiv - Plant Biology 2024Quote: ... and subsequently incubated with rat monoclonal anti-tubulin YL-1/2 antibody (Sigma-Aldrich) at 1:100 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... and 6-chloro-1,2-benzisoxazol-3(2H)-one (CBIO) were purchased from Sigma Aldrich. Phorbol 12-myristate 13-acetate was purchased from Cayman Chemical ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... phosphatase inhibitor cocktail 2 (P5726) and 3 (P0044) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and Doxorubicin (Adriamycin ...
-
bioRxiv - Cell Biology 2024Quote: ... DLD1 cells were treated for 2 h with 0.5 mM 3-indoleacetic acid (Sigma, stock in ethanol). At the time points indicated ...
-
bioRxiv - Neuroscience 2024Quote: ... after 2-3 months of receiving HFD the mice were given 75 mg/kg STZ (Sigma-Aldrich) in 0.1M sodium citrate buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...
-
bioRxiv - Neuroscience 2022Quote: ... Internal solutions also contained 3-5mg/mL (0.3%-0.5%) of biocytin (Sigma-Aldrich, CAS# 576-19-2) which was added the day of recording.
-
bioRxiv - Systems Biology 2022Quote: ... The virus was collected both 2 days and 3 days later and 0.45 μm syringe filters (Millipore) were used to eliminate cells ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed 3 times in PBS before addition of 2% Triton X–100 (Sigma-Aldrich) PBS solution to lyse the cells for enumeration of the intracellular bacteria ...
-
bioRxiv - Cancer Biology 2023Quote: 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...