Labshake search
Citations for Millipore Sigma :
8551 - 8600 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... then bound proteins were eluted with 3 mM desthiobiotin (Sigma) or 50 mM D-biotin (CHEM-IMPEX ...
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Phosphatase Inhibitor Cocktail no.2 and no.3 (Sigma). Following manufactures recommendations ...
-
bioRxiv - Immunology 2019Quote: ... and incubated in blocking buffer (3% BSA (#A7906, Sigma, USA) in PBS supplemented with 0.1% Triton X-100 (#9002-93-1 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 mM of HCL (Millipore Sigma, cat no. HX0603-3), and 0.5 mM of iron (II ...
-
bioRxiv - Immunology 2019Quote: The macrophages were activated by 3 μg/mL LPS (Sigma) and 100 pmol IFN-γ for 6 hrs ...
-
bioRxiv - Physiology 2020Quote: ... containing 3% (w:v) bovine serum albumin (BSA) (Sigma Aldrich, Australia), 1 mg/ml Type 2 Collagenase (Sigma Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... followed by blocking of endogenous peroxidase with 3% H2O2 (Sigma H-1009 ...
-
bioRxiv - Genetics 2019Quote: ... 0.1 mg/ml 3-sn-Phosphatidic acid sodium salt (Sigma) respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Genejuice (EMD Millipore) and 1 μg plasmid DNA ...
-
bioRxiv - Genomics 2019Quote: ... and 0.25 mM (days 3-10) ascorbic acid (Sigma-Aldrich).
-
bioRxiv - Bioengineering 2019Quote: ... and (3-aminopropyl)trimethoxysilane (24 mL) (APTMS 97%, Sigma-Aldrich). The mixture was incubated in an oil bath at 40 °C with magnetic stirring at 400 rpm for 16 h ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by addition of 3 mL ethylene glycol (Sigma-Aldrich) to remove unreacted sodium periodate ...
-
bioRxiv - Immunology 2019Quote: ... After 3 minutes 200μl of 0.5% Evans Blue dye (Sigma) was injected into the tail vein ...
-
bioRxiv - Immunology 2021Quote: ... JEG-3 were pre-treated with 10 μM salubrinal (Sigma) for 1 h before infection ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated with TO-PRO-3 iodide (T3605, Sigma) for 30 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... IL-1β (SIGMA, #SRP8033, i.p., 3 μg/kg body weight).
-
bioRxiv - Bioengineering 2021Quote: ... was filled with 3 ml of Histopaque 1119 (Sigma Aldrich); then ...
-
bioRxiv - Bioengineering 2021Quote: ... 20.5 µL of N-[3-(dimethylamino)propyl]methacrylamide (Sigma-Aldrich), and 309 µl of 1 mM HEPES buffer were combined and mixed by vortexing ...
-
bioRxiv - Bioengineering 2021Quote: ... After blocking with 3% bovine serum albumin (BSA, Sigma-Aldrich) for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Collected elutes were concentrated to 2.5-3 ml by Millipore Amicon Ultra-15 (30,000 MWCO ...
-
bioRxiv - Neuroscience 2021Quote: ... and then blocked with 3% Bovine Serum Albumin (BSA, Sigma) with 0.1% Triton X-100 in DPBS for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 3% B where solvent A = 0.1% formic acid (FA, Sigma) in water (Thermo-Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... as above and phosphatase inhibitors (Cocktails 2 and 3, Sigma). Proteins were quantified by Bradford assay (Biorad) ...
-
bioRxiv - Microbiology 2021Quote: ... Erythrocytes were supplemented with 3 units/ml heparin (Sigma-Aldrich). Parasites were grown in asexual parasite culture medium (RPMI 1640 with 25 mM HEPES (Life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... that we activated with 3-(trimethoxysilyl) propyl methacrylate (Sigma-Aldrich) in ethyl alcohol (Pharmco-Aaper ...
-
bioRxiv - Cancer Biology 2020Quote: ... was acquired from MedChemExpress and XRP44X (Ras-Net-Elk-3 inhibitor) from Sigma-Aldrich. The drugs were reconstituted in DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... treated with 0.5% 3-Aminopropyl triethoxysilane (APTS) (Sigma Aldrich A3648) for 3 minutes then with 0.5% Glutaraldehyde (Sigma Alrich G6257 ...
-
bioRxiv - Bioengineering 2021Quote: ... for 3 minutes then with 0.5% Glutaraldehyde (Sigma Alrich G6257) for 30 minutes ...
-
bioRxiv - Biochemistry 2020Quote: Rosetta 2(DE3)pLysS (EMD Millipore Novagen, Cat. # 71403-3)
-
bioRxiv - Biochemistry 2020Quote: Rosetta 2(DE3)pLysS (EMD Millipore Novagen, Cat. # 71403-3)
-
bioRxiv - Bioengineering 2021Quote: ... a solution of 3% bovine serum albumin (BSA, Sigma-Aldrich) in BRB80 buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5% NP-40 containing 3× phosphatase inhibitor cocktail (Sigma-Aldrich) and 3× EDTA-free complete protease inhibitor cocktail (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 3 g/L Gelzan™ Gelrite® (Sigma-Aldrich) and growth chamber under 16-h photoperiod at 22 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... Lanolin paste containing Indole-3-acetic acid (IAA, Sigma-Aldrich) (10 mg of IAA per 1g of lanoline ...
-
bioRxiv - Plant Biology 2020Quote: ... and 3 g/L Gelzan™ Gelrite® (Sigma-Aldrich) and incubated in a growth chamber under 16-h photoperiod at 22 °C ...
-
bioRxiv - Microbiology 2020Quote: ... then were blocked with PBS-3% BSA (Sigma–Aldrich, USA) for 3 h at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... using 3 kDa MW cut-off filter units (Merck Millipore). In order to detect and quantify the amount of NGF ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mL of agar containing 0.02% neutral red (Sigma-Aldrich) was overlaid onto cells ...
-
bioRxiv - Neuroscience 2020Quote: ... N,N-diethyl-3-methylbenzamide (hereafter DEET) from Sigma-Aldrich and coelenterazine from Biosynth ...
-
bioRxiv - Bioengineering 2019Quote: ... HUVECs were mixed with dextran-coated Cytodex 3 microcarriers (Sigma) at a final concentration of 400 cells per bead in one millilitre of growth medium ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and sn-glycerol-3-phosphate were purchased from Sigma Aldrich. PUREfrex 2.0 and its Sol.I buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... auxin (indole-3-acetic acid sodium salt, Sigma-Aldrich #I5148) was added to the culture medium in a final concentration of 0.5 mM for indicated times.
-
bioRxiv - Microbiology 2019Quote: ... and 25 U/mL of benzonase (Merck-Millipore, 70664-3)] ...
-
bioRxiv - Cancer Biology 2020Quote: ... incised and incubated with Collagenase P (3 U/ml; Sigma) at 37 °C with agitation (200 rpm ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3% Bovine Serum Albumin (BSA) (Sigma-Aldrich, Steinheim, Germany) in PBST for 30 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Losartan (AT1-R blocker) (3 mg/kg/day, Sigma-Aldrich), LOX-1 neutralizing antibody (0.6 mg/kg/day ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-SMAD2/3 antibodies (Millipore, 07-408 - Burlington, MA).
-
bioRxiv - Cell Biology 2022Quote: ... The resin was washed 3 x with TNE buffer (Sigma) and then an equal volume of 2 x SDS loading sample buffer was added ...
-
bioRxiv - Cancer Biology 2022Quote: ... diluted in 3% bovine serum albumin (Sigma-Aldrich Cat# 9647) in Tris-buffered saline with 0.1% TWEEN 20 ...