Labshake search
Citations for Millipore Sigma :
801 - 850 of 3415 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Negative controls consisted of transfection with the MISSION siRNA Universal Negative Control (Sigma-Aldrich; Cat#SIC001; Lot#WDAA1199). Predesigned MISSION siRNA’s targeting individual genes were ordered from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... universal MISSION® siRNA Universal Negative Control #1 (cat. SIC001) and #2 (cat. SIC002) were from Millipore Sigma. We used the DharmaFECT 4 Transfection Reagent (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... The following siRNA molecules used against the coding sequence of Pol κ (Polκ) (5’CCAAUAGACAAGCUGUGAU3’ from Sigma-Aldrich), the 3’UTR of Pol κ (Polκ3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells grown for 48 hours following siRNA transfection were supplemented with 100 µg/ml CHX (Sigma, cat# C4859) or an equal volume of DMSO (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... small interfering RNAs (siRNAs) and scrambled controls (scRNAs) designed for astikine and hemocytin were synthesized by Millipore Sigma with UU overhangs ...
-
bioRxiv - Cell Biology 2023Quote: ... Desalted siRNA duplexes modified by double-deoxythymidine overhangs at 3’-ends of both strands were synthesized by Sigma. The AllStar siRNA (QIAGEN ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control siRNAs for LonRF (oligo # 3012482021-000160, -000170) and UBB (oligo # 3030837381-000300, -000310) were purchased from Sigma. Sequences of all other siRNAs (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the liposomes without curcumin were prepared and complexed with Cyanine 5 (Cy5)-labeled siRNA (Sigma Aldrich, Missouri, USA). Cells were seeded onto µ-Dish 35 mm Petri dishes (Ibidi ...
-
bioRxiv - Systems Biology 2024Quote: ... Producing clones were stimulated for siRNA production by the addition of doxycycline (1 µg/mL) (Sigma, D9891-1G) for 24h ...
-
bioRxiv - Bioengineering 2020Quote: ... Negatively selected human monocytes (Astarte Biologics) were suspended in RPMI 1640 supplemented with 2% human AB serum (Sigma-Aldrich), 1% GlutaMax (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 (human embryonic kidney) and U2OS (human bone osteosarcoma) cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich) supplemented with 10 % FBS ...
-
bioRxiv - Biochemistry 2024Quote: Human embryonic kidney cells (HEK293T) and human fibroblast cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Sigma Aldrich), supplemented with fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... Detection of IgG1 employed anti-human IgG (VH+VL) (Jackson) and of IgA2 anti-human IgA (Hc only) (Sigma). Commercial antibodies were used at dilutions recommended by manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... The concentrations of the human mAbs were interpolated from the linear range of concurrently run purified human IgG (Sigma) standard curves using Prism software ...
-
bioRxiv - Biochemistry 2024Quote: Human C-reactive protein (Cat. No. C4063) and Human erythrocyte catalase (Cat. No. C3556) were obtained from Sigma Aldrich chemicals ...
-
bioRxiv - Systems Biology 2021Quote: ... purified LC and naïve CD4+ T cells or TRMs were co-cultured in human serum supplemented media (RPMI, Gibco, UK, 10% human serum, Sigma, UK ...
-
bioRxiv - Cancer Biology 2020Quote: Human neutrophils were obtained from fresh human peripheral blood from healthy volunteers and were isolated using a Percoll (Sigma-Aldrich) gradient.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were probed with polyclonal goat anti-human ACE2 (1:500, AF933, R&D Biosystems) or rabbit anti-human beat-Actin (1:2500, 6L12, Sigma) followed by donkey anti-goat IRdye 680CW or goat anti-rabbit IRdye 800CW (Abcam) ...
-
bioRxiv - Physiology 2020Quote: ... For insulin clearance during an insulin challenge, mice were given human insulin (1 U/kg, NovoRapid) or human C-peptide (50 µg/kg, Sigma) by intraperitoneal injection and blood samples were collected by tail vein sampling at 0 ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were probed with 1 in 10,000 dilution of human anti-SIC followed by 1 in 50,000 dilution of HRP-conjugated goat anti-human IgG (Sigma-Aldrich). To directly compare detection of SIC fragments by purified human and rabbit anti-SIC antibodies ...
-
bioRxiv - Cell Biology 2022Quote: The human alveolar carcinoma epithelial cell line A549 (ATCC, CCL-185) and human colorectal adenocarcinoma cell line HT29 (Sigma Aldrich) were utilized for toxicological evaluation ...
-
bioRxiv - Microbiology 2020Quote: ... 15 µl of secondary antibody (anti human Fab-HRP: Jackson ImmunoResearch, cat# 109-035-097; anti human IgG-HRP: Sigma, cat# A6029-1ML ...
-
bioRxiv - Immunology 2022Quote: ... alpha enolase (in-house expressed human) and collagen II (bovine purified, chondrex) and at 0.5 μg/ml hIgG1 to citrullinated fibrinogen (human purifed, Sigma Aldrich).
-
bioRxiv - Microbiology 2023Quote: Primary human macrophages (MΦs) were cultured in macrophage medium (RPMI-1640 GlutaMAX™ (Thermo) supplemented with 4% human AB serum (Sigma), 100 μg/ml penicillin-streptomycin (Sigma) ...
-
bioRxiv - Systems Biology 2024Quote: ... The cells were then incubated with 1ug/ul primary antibody (For TRUB1 staining, TRUB1 Rabbit anti-human polyclonal, 50-172-8037, Protein tech; for PUS7 staining, PUS7 Rabbit anti-human, HPA024116, Sigma) in 1% BSA/PBS-Triton (0.1% ...
-
bioRxiv - Microbiology 2021Quote: Adult female worms were incubated with 5 μM of 5’ cy3-labeled Bma-lad-2 siRNA 1 (Sigma Aldrich) for 24 hrs to evaluate uptake of siRNA into intestinal tract epithelial cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... and p53 intron-9 (gaugcuacuugacuuacga) (Marcel, Fernandes et al. 2014) and total p53 (gagguuggcucugacugua, siRNA ID: SASI_Hs02_00302766) were purchased from SIGMA-ALDRICH. 700,000 to 1 million cells were plated in 100mm tissue culture plates overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... (2×103-5×103) siRNA reverse transfected endothelial cells (24h or 48h post transfection) were seeded to fibronectin (Sigma)-coated E-plates (growth ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA targeting the LIM domain of EPLIN (# SASI_Hs02_00326071; TATTGTAAGCCTCACTTCAA) and a scrambled control siRNA (#SIC001) were obtained from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl plasmid vectors (2 μg) and/or siRNA oligos (0.1 nmol) containing 0.05% fast green FCF (Sigma-Aldrich) were injected into each DRG ...
-
bioRxiv - Cancer Biology 2023Quote: ... Scramble siRNA was utilized as a negative control in each experiment at the same concentration (Sigma-Aldrich cat. #: SIC001). This siRNA mixture was added to 1.5 mL fresh complete medium on the cells ...
-
bioRxiv - Genetics 2023Quote: The siRNA screen was performed in 384-well round bottom plates coated with poly-D-lysine (Sigma-Aldrich #P7886). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... four different siRNAs targeting ALKBH5 CDS (ACAAGUACUUCUUCGGCGA[dT][dT], GCGCCGUCAUCAACGACUA[dT][dT], CUGAGAACUACUGGCGCAA[dT][dT], AAGUCGGGACUGCAUAAUUAA[dT][dT], Sigma) were used at concentration 20 nM (5nM each siRNA) ...
-
bioRxiv - Bioengineering 2024Quote: ... siRNA-CQ-L2 conjugates were cleaved from the columns using 1:1 ammonium hydroxide:methylamine (40% in H2O, Millipore Sigma) followed by desalting ...
-
bioRxiv - Biophysics 2021Quote: ... Plasminogen (human plasma purified protein, Sigma-Aldrich, Germany) and Fibrinogen (human plasma purified protein ...
-
bioRxiv - Biophysics 2021Quote: ... and Fibrinogen (human plasma purified protein, Sigma-Aldrich). Experimental conditions are presented in the table I.
-
bioRxiv - Biophysics 2021Quote: Plasminohen (human plasma purified protein, Sigma-Aldric, Germany)
-
bioRxiv - Cancer Biology 2021Quote: ... and Human specific Ki67 (MAB4383, 1:500, Millipore), followed by secondary antibody Envision+ anti-mouse labeled-polymer (Dako/Agilent) ...
-
bioRxiv - Biochemistry 2020Quote: LX-2 human hepatic stellate cells [47] (Millipore) were cultured in DMEM supplemented with 10% fetal bovine serum at 37°C under 5% CO2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg/ml recombinant human insulin (Sigma). BT474 cells were cultured in RPMI 1640 supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... human plasma-derived (Sigma, Cat. No #: F4883-500MG) were purchased from Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... human plasma-derived (Sigma, Cat. No #: T6884-100UN) and Fibronogen ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg/ml of recombinant human insulin (Sigma), 2 IU/ml heparin (Affymetrix) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human cells were pretreated with glycine (Millipore, 104201) at a concentration of 50 mM for at least 10 minutes before stimuli was added.
-
bioRxiv - Bioengineering 2022Quote: ... human [Leu15]-gastrin I (10 nM; Millipore Sigma), N-acetyl cysteine (500 μM ...
-
bioRxiv - Immunology 2022Quote: ... and 0.5% recombinant human serum albumin (Sigma Aldrich). Microfluidic droplets were generated as water-in-oil emulsions using a co-flow of aqueous phases ...
-
bioRxiv - Bioengineering 2020Quote: ... human VEGF ELISA kit (RAB0507-1KT, Sigma Aldrich), glutaraldehyde solution (340855 ...
-
bioRxiv - Bioengineering 2020Quote: ... sterile fibrinogen from human plasma (Millipore Sigma, 341576) was dissolved in sterile PBS (Corning ...
-
bioRxiv - Biochemistry 2020Quote: 400 μL human male serum (Sigma; cat. #H4522) was incubated at 37 °C for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... with 6.3 µM human holo Tf (Sigma-Aldrich) in 0.1 M carbonate buffer (1 ml ...