Labshake search
Citations for Millipore Sigma :
801 - 850 of 1956 citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... DNA content was measured using a Guava EasyCyte HT flow cytometer (Millipore) and analyzed with FlowJo software (FlowJo ...
-
bioRxiv - Molecular Biology 2020Quote: ... including pretreatment of DNA with Nuclease P1 (N8630, Sigma-Aldrich/Merck, Darmstadt, Germany) and alkaline phosphatase (Sigma-Aldrich/Merck) ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA containing fractions were loaded on a C18 SepPak Plus cartridge (Waters/Millipore), washed with 0.1 − 0.15 M (Et3NH)+HCO − ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with 10 μg/ml Hoechst for 20 min (Sigma-Aldrich). Coverslips were washed three times with TBS-Tx (TBS with 0.1% Triton X-100 ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was visualized by incubating cells in 1 ug/ml Hoechst33342 (Sigma-Aldrich) in PBS plus 0.1% Triton X-100 for 10 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... biotinylated DNA was purified using 250 μL slurry of streptavidin-agarose beads (Sigma). DNA was cleaved from the beads with DpnII and libraries were prepared for sequencing using the NEBNext DNA Library Prep Master Mix Set for Illumina (New England BioLabs).
-
bioRxiv - Neuroscience 2021Quote: ... R399Q and F101Y into dolphin Prestin using KOD DNA polymerase (71085 - EMD Millipore). All mutant and wild type constructs were confirmed by DNA sequencing prior to structural and electrophysiological experiments.
-
bioRxiv - Molecular Biology 2021Quote: ... The captured DNA-RNA hybrids were enriched by protein A-agarose beads (Millipore). The purified DNA was used to construct a library with the NEXTflex Rapid DNA-seq Kit (PerkinElmer).
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA purifications were performed using bacterial gDNA extraction kits from Sigma Aldrich. Plasmid DNA was purified with mini-prep kits from NEB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1, Sigma-Aldrich) and ethanol precipitated ...
-
bioRxiv - Microbiology 2020Quote: ... or the GenElute Bacterial DNA extraction kit (#NA2110, Millipore Sigma, St. Louis, MO). The other half was archived at −80 °C.
-
bioRxiv - Genomics 2019Quote: ... We added a spike-in of digested unmethylated lambda phage DNA (Sigma Aldrich) to each sample at a concentration of 0.1% of the sample concentration ...
-
bioRxiv - Genetics 2019Quote: ... Three gBlock dsDNA templates were amplified with KOD HotStart DNA polymerase (EMD Millipore) using primers ErCas12af1/ErCas12aAr1 ...
-
bioRxiv - Biophysics 2019Quote: ... We visualized PCR products and DNA plasmids by 1 % agarose (SIGMA Cat.#A9539) gel dyed with GelRed (BIOTIUM Cat.#41003) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a DNA probe specific to tRNAPhe ([Btn]AAATGGTGCGAATTCTGTGGATCGAACACAGGACCTCCAGATCTTC, Sigma-Aldrich, Munich, Germany) as previously reported (67).
-
bioRxiv - Cell Biology 2019Quote: ... and DNA loaded proteins were released by incubation with S7 nuclease (Sigma Aldrich) in complete CSK at room temperature (RT ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Genomic DNA was removed by digestion with Amplification Grade DNase I (Sigma-Aldrich). First-strand cDNA was synthesized by reverse transcription of 5μg of total RNA with Superscript-II reverse transcriptase (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: PCR master mix: 1x KOD Xtreme Hot Start DNA Polymerase buffer (EMD Millipore), 1.2 µM (each ...
-
bioRxiv - Microbiology 2019Quote: ... The herpesvirus DNA replication inhibitor thymine 1-β-D-arabinofuranoside (AraT) (Millipore Sigma) was added at a concentration of 100μg/ml 15 minutes prior to infection.
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... 0.5mg/ml salmon tests DNAs (Catalog #D7656, Sigma-Aldrich Co, St. Louis, MO) in ChIP dilution buffer were added for extra 4 hrs of incubation at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA was amplified using KOD Xtreme Hot Start DNA Polymerase (Millipore Sigma). Specifically ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA solution (diluted in Milli-Q water and < 5% trypan blue (Sigma: T8154)) was injected into lateral ventricles of embryos via a pulled glass capillary (Drummond ...
-
bioRxiv - Biochemistry 2021Quote: Transient transfection of 293T cells was performed using polyethyleneimine–DNA complexes (Sigma-Aldrich) as described previously (56) ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated from harvested calf thymocytes using the GenElute kit (Sigma) after washing the cell pellets twice with PBS ...
-
bioRxiv - Bioengineering 2021Quote: The cells were assayed by fluorescence imaging of DNA (Hoechst 33342, B2261, Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: ... DNA was sheared as described above and removed by addition of Benzonase (Millipore) for 1h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was visualized by incubating cells in 1 ug/mL Hoechst33342 (Sigma-Aldrich) in PBS plus 0.1% Triton X-100 for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA fragments were PCR-amplified with KOD Hot Start Master Mix (Novagen®) from genomic DNA of M ...
-
bioRxiv - Biochemistry 2020Quote: ... Resulting DNA fragment was cloned into NheI/HindIII sites of pET28a+ plasmid (Novagen) to generate pET28-S plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclear DNA was counterstained with 5 μg mL−1 Hoechst 33342 (Sigma-Aldrich) and the coverslips washed and mounted with Vectashield mounting medium (Vector laboratories ...
-
bioRxiv - Microbiology 2020Quote: Total DNA and RNA were extracted from samples using TRiZOL reagent (Sigma Aldrich) according to manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DNA fragments were either PCR-amplified with oligonucleotide primers (Sigma-Aldrich and IDT) or ordered as gBlocks from IDT and cloned into Gateway pENTR plasmids ...
-
bioRxiv - Microbiology 2021Quote: PCR reactions were carried out with either KOD Hot Start DNA Polymerase (Sigma) or iProof DNA Polymerase (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... the DNA methyltransferase inhibitor 5-aza-2 deoxycytidine was from Sigma-Aldrich (A3656), Polyethylenglycol 300 (PEG300 ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA solution was further purified using a GenElute Agarose Spin Column (SIGMA). Serial 10-fold dilutions (10−2 to 10−9 ...
-
bioRxiv - Neuroscience 2021Quote: ... Roche Digoxigenin (DIG)-labeled DNA Molecular Weight Marker III (Millipore Sigma can# 11218603910) was loaded as a marker ...
-
bioRxiv - Cell Biology 2020Quote: ... Conventional PCR was performed using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore). The fragments were cloned into pCR-Blunt II TOPO using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA was stained for imaging using Duolink mounting medium with DAPI (Sigma #DUO82040). PLA foci were quantified using JQuantPlus software [67].
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... single stranded DNA (Deoxyribonucleic acid, single stranded from Calf Thymus, Sigma, Catalog # D8899), cardiolipin (Cardiolipin sodium salt from bovine heart ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was transferred to a positively-charged nylon membrane (Millipore, Billerica, MA, USA) by the capillary method and hybridised with digoxigenin-labelled blaOXA- 58 and blaNDM-1-specific probes with an NBT/BCIP colour detection kit (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA was subsequently checked for DNA by PCR using RedTaq readymix (Sigma). RNA integrity was assessed using 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... A standard curve of human genomic DNA from buffy coat (Sigma-Aldrich #11691112001) along with positive and negative controls were included on each of plates to assess plate-to-plate variability and ensure that values fell within measurement range ...
-
bioRxiv - Microbiology 2022Quote: ... Free DNA was removed before purification by treatment with Benzonase endonuclease (Millipore Sigma). Isolated viral particles are a mixture of pseudoviruses ...
-
bioRxiv - Immunology 2020Quote: ... The digested DNA was incubated with AA7 (Sigma Aldrich, 10 mM final concentration) at 37 °C for 1 hour to block pre-existing abasic sites ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... DNA were transfected with the same volume of X-tremeGENE (Sigma, MO, USA) and 100 μl of Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... S9.6 antibody that binds to RNA/DNA hybrid was purchased from Millipore (MABE1095).
-
bioRxiv - Biochemistry 2020Quote: ... Results were also verified with DNA and RNA primers purchased from Sigma-Aldrich Merck KGaA ...
-
bioRxiv - Neuroscience 2020Quote: ... Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase, Sigma-Aldrich) from a mouse brain cDNA library using the forward primer ...
-
bioRxiv - Genetics 2022Quote: ... with the GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich, St Louis, MO) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... Purified DNA was concentrated using Amicon Ultra-0.5 Centrifugal Filter Unit (Millipore, UFC501096) and concentration adjusted ...