Labshake search
Citations for Millipore Sigma :
701 - 750 of 1956 citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... and the DNA recovered by electroelution (Novagen D-tube dialyzer, 3.5 kDa) in 0.2X TBE ...
-
bioRxiv - Microbiology 2019Quote: ... The AphA-DNA complexes were immunoprecipitated with an anti-FLAG antibody (Sigma) and Protein A sepharose beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was then concentrated on Amicon ultra 0.5 30K filter units (Millipore), biotin-pulldown performed using MyOne Streptavidin T1 beads (Life technologies ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 U DNA recombinant Taq polymerase in buffer (pH= 8.0; Sigma, Germany), 1x PCR buffer (pH=8.7 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The DNA pellet was resuspended in 0.5 ml TE buffer (Sigma T9285) and incubated at 65°C for one hour ...
-
bioRxiv - Microbiology 2021Quote: ... falciparum DNA and oligonucleotides for the guide RNAs were ordered (Sigma-Aldrich). Correct sequence and integration of both inserts was confirmed by Sanger Sequencing.
-
bioRxiv - Bioengineering 2020Quote: ... DNA content was quantified with Hoechst Bisbenzimide 33258 dye assay (Sigma-Aldrich) as described previously [31] ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: ... Residual DNA was digested with 10 μg mL−1 DNase I (Sigma). Matrices were either fixed with 4% paraformaldehyde and stained for fibronectin ...
-
bioRxiv - Cancer Biology 2020Quote: ... The DNA was labeled by incubation of cells with DAPI solution (Sigma, D9542 ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA was stained with 20 μM Hoechst 33342 (Sigma, #23491-52-3) and coverslips were mounted on glass slides with Mowiol 4-88 (Calbiochem ...
-
bioRxiv - Bioengineering 2021Quote: ... Digested DNA was filtered through Amicon Ultra 10K centrifuge filters (EMD Millipore) to remove undigested polynucleotides and collected for LC-MS/MS ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore). All enzymes ...
-
bioRxiv - Neuroscience 2020Quote: ... nAChRα5 and nAChRα6 DNA oligonucleotide sets were synthesised by Sigma-Aldrich (Merck) and enzymatically labelled with ATTO-633 according to (Gaspar et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... The DNA was probed with the S9.6 antibody (1:1000 dilution, Millipore) in 1% BSA/TBST overnight at 4 °C after UV-crosslinking (0.12 J/cm2 ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was visualized using Fluoroshield with 4,6-diamidino-2-phenylindole (DAPI, Sigma). Images were acquired using a Zeiss LSM 710 confocal microscope and subsequently processed using the ImageJ software package.
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with 50 ng/mL Hoechst® 33342 (Sigma-Aldrich) or 20 nM SiR-DNA (Spirochrome ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA isolation was performed using 25:24:1 phenol:chloroform:isoamyl alcohol (Sigma Aldrich) followed by ethanol precipitation of DNA for 1 hour at −20°C (Input DNA was isolated using the same procedure) ...
-
bioRxiv - Cell Biology 2021Quote: ... Complementary DNA was obtained using SuperScript III First-Strand Synthesis System (Sigma) with random hexamer primers running on a MasterCycler EpGradient 5341 thermal cycler (Eppendorf AG ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA probes diluted in the Hybridization Buffer (20%dextransulfate (Sigma Aldrich #D8906), 2xSSCT ...
-
bioRxiv - Biochemistry 2022Quote: ... approximately 20 nmol DNA was mixed with 300 nmol fluorescein isothiocyanate (Sigma) in a final volume of 100 µL Borax buffer (0.1 M Sodium Tetraborate pH 8.5) ...
-
bioRxiv - Microbiology 2021Quote: ... The VpsT-DNA complexes were immunoprecipitated with an anti-FLAG antibody (Sigma) and Protein A sepharose beads ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Millipore 71842-3) using primers KL207/KL200 for the sfgfp gene and primers BAC338F/BAC805R for the 16S rRNA gene48.
-
bioRxiv - Microbiology 2021Quote: ... plasmid DNA was isolated using GenElute ™ Plasmid Miniprep Kit (Sigma-Aldrich) and sequenced using the M13 primers ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was diluted to 0.2 ng/μL in water (Sigma-Aldrich, Sweden), and the samples were prepared for whole genome sequencing according to Nextera® XT DNA Library Preparation Guide (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2019Quote: ... staining DNA in both Pv11 and Sf9 with Hoechst 33258 (Sigma, USA). In the case of the PvLEA3 and PvLEA22 proteins ...
-
bioRxiv - Microbiology 2021Quote: ... solutions were incubated with X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) for at least 15 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was stained with 50 µg/ml propidium iodide (PI; Sigma # P4864). Cells were processed in a FACSCanto cytometer (BD Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (Novagen®), following standard protocols ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... supplemented with 12.5-25 µg of sonicated salmon sperm DNA (Sigma-Aldrich). For 18S rDNA FISH on synaptonemal complexes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1, Sigma), washed with chloroform and precipitated with 3 volumes ethanol ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA plasmids mixed in saline (PBS) solution and 0.025% Fast Green (Sigma) were injected through the uterine wall into the lateral ventricle of each embryo ...
-
bioRxiv - Molecular Biology 2020Quote: ... A PCR with REDTaq® DNA polymerase (Sigma-Aldrich, Saint Louis, Missouri) was performed and the length of the amplified products was checked by 1% agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... and 45% for DNA-RNA immunoprecipitation with S9.6 antibody (MABE1095 Millipore-SIGMA) and Dynabeads Protein G overnight at 4 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... and 45% for DNA-RNA immunoprecipitation with S9.6 antibody (MABE1095 Millipore-SIGMA) and Dynabeads Protein G overnight at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Powdered chemical reagents and custom DNA primers were purchased from Sigma-Aldrich. Mass spectrometry (MS ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were stained for DNA (SYBR Green I, 1:5000; Sigma-Aldrich), and for chitin (1 μg/ml Calcofluor white ...
-
bioRxiv - Microbiology 2021Quote: ... Water samples were collected for DNA sequencing on 0.2 μm Sterivex (Millipore) filter cartridges connected in-line with tubing (flushed with the sample prior to filtration ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... KOD Hot-Start DNA Polymerase was obtained from Novagen (Merck, Darmstadt, Germany). Restriction enzyme DpnI was bought from New England Biolabs (Ipswich ...
-
bioRxiv - Immunology 2019Quote: ... and then washed and incubated the plates with calf thymus DNA (Sigma) overnight at 4 °C ...
-
bioRxiv - Immunology 2019Quote: ... together with 20 μg/ml calf thymus DNA (Sigma) (Millipore, Billerica, USA) and then used 2% FCS in PBS to block the plates[20] ...
-
bioRxiv - Genetics 2019Quote: ... Immunoprecipitated DNA was purified using 30 μl of protein A beads (Sigma), which were washed prior to DNA elution and cross-link reversal as previously described [16 ...
-
bioRxiv - Plant Biology 2019Quote: ... and salmon sperm DNA/protein A agarose beads (Millipore, Billerica, MA, USA) were used for ChIP experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... Tail DNAs were extracted by Proteinase K digestion (Sigma-Aldrich; RPROTK-RO) in Tail Lysis Buffer (10 mM Tris pH 8.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA oligonucleotides or vector construction and sequencing were obtained from Millipore Sigma, synthetic DNA fragments for Gibson Assembly – from IDT ...
-
bioRxiv - Cancer Biology 2021Quote: ... and DNA was digested during RNA extraction using on-column DNAse (Sigma, On-Column DNAse I digestion set ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA probes diluted in the Hybridization Buffer (20%dextransulfate (Sigma Aldrich #D8906), 2xSSCT ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using KOD Xtreme™ Hot Start DNA Polymerase (Millipore, 71975) and the primers TCGATGCTCTGTTTCGAATG and CTTCTTCCCCCTTGCCTTAC flanking the targeted deletion site ...
-
bioRxiv - Cell Biology 2021Quote: ... The eluted DNA was then purified via phenol:chloroform:isoamylalcohol (pH 8.0, Sigma P2069) and subsequently ethanol precipitated ...
-
bioRxiv - Immunology 2021Quote: ... herring testes (HT)-DNA (1-4µg/ml as indicated; Sigma D6898-250MG), LPS (100ng/ml ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids were purified with the GenElute Plasmid DNA Miniprep Kit (Sigma-Aldrich), quantified using the Qubit fluorometer (Thermo Fisher ...