Labshake search
Citations for Millipore Sigma :
801 - 850 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... or the Kv7 channel activator retigabine (10−8 M to 3·10−5 M, Sigma). Some PAs were treated with XE991 (3·10-8-3·10-6 ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Systems Biology 2020Quote: ... We changed medium 2 days later (Day -2) with addition of 3 μg/mL Doxycycline (Sigma D9891) to induce the NIL transcription factors ...
-
bioRxiv - Cell Biology 2022Quote: ... at passages 4-5 were cultured on Millicell EZ 8-well glass slides (Millipore) pre-coated with gelatin (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... different amounts of freeze dried GelMA macromer were dissolved in DPBS containing 0.5% (w/v) 2-Hydroxy-4’-(2-hydroxyethoxy)-2- methylpropiophenone (Sigma-Aldrich) as photoinitiator ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were washed four to five times with warm media (DME-HG for MEFs and DME-HG/F12 for MCF10A) and pulse-labeled with 100 µM 5- chloro-2’-deoxyuridine (CldU; Sigma) for 20 min at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... 100μM 2-mercaptoethanol (Sigma #63689-25ML-F), penicillin and streptomycin (BioConcept #4-01F00-H) ...
-
bioRxiv - Immunology 2023Quote: ... F(ab’)2 (Sigma-Aldrich; Cat#AQ500) Armenian Hamster Anti-CD40 (Clone HM40-3 ...
-
bioRxiv - Biochemistry 2022Quote: ... were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt, Aldrich) or negatively charged 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS, Sigma-Aldrich, Inc) containing N,N’-methylenebisacrylamide (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged 1800 rpm for 6 minutes at 4°C and pellets were resuspended n 3 mL RBC lysis for 4 minutes (Sigma). Samples were centrifuged 1800 rpm for 6 minutes at 4°C and the pellets were resuspended in 200 μl of PBS + 2% FBS + 2 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting adhered bacteria on the cover slip were stained with 200 μL of the membrane stain N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) (Sigma) at a final concentration of 20 μg/mL for 5 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Systems Biology 2024Quote: ... and kept at 4°C for a maximum of 4 hours until plasma was separated via centrifugation (2600g for 10 minutes at 4°C) (Sigma 3-16KL, Sigma Laboratory Centrifuges ...
-
bioRxiv - Biophysics 2020Quote: ... passaged every 3-4 days by trypsinization with trypsin-EDTA solution (Sigma-Aldrich) and moved to the corresponding Petri dishes ...
-
bioRxiv - Plant Biology 2021Quote: Starting reagents 3-hydroxybenzaldehyde 4 and hydrazine hydrate were purchased from Sigma-Aldrich and phenylacetic acid 1 was purchased from Merck ...
-
bioRxiv - Cancer Biology 2021Quote: ... noggin and EGF and containing 10 µM nutlin-3 (Sigma #675576-98-4).
-
bioRxiv - Neuroscience 2020Quote: ... The odorants used were 0.1% 3-octanol and 0.1% 4-methylcyclohexanol (Sigma Aldrich), controlled via three-way solenoids (Lee Company) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3×10-4 M monothioglycerol and 300 μg/ml human transferrin (Sigma Aldrich). Cells were plated in petri dishes (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked overnight at 4°C in DPBS with 3% BSA (Sigma, A9647) and 0.05% TritonX-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... For ECM conjugation using L-DOPA (3, 4- Dihydroxy-L-phenylalanine, D9628, SIGMA),[23] 2 mg ml-1 L-DOPA solution was prepared using 10 mM Tris-HCL buffer (pH balanced to 10.2 using 1 M NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... coverslips were transferred to a 4% solution of (3-aminopropyl) triethoxysilane (Sigma #440140) in acetone for one hour ...
-
bioRxiv - Microbiology 2023Quote: ... and used without further purification: 4-Hydroxy-3-methoxycinnamaldehyde (458-36-6, Sigma), 3-ethoxy-4-hydroxybenzaldehyde (121-32-4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... metabolic activity by the tetrazolium salt 2,3-bis(2- methoxy-4-nitro-5-sulfophenyl)-5-(phenylamino)-carbonyl-2H-tetrazoliumhydroxidand (XTT; Sigma-Aldrich, USA) reduction assay ...
-
bioRxiv - Cell Biology 2023Quote: ... and postfixed with 4% cold PFA for 10 min followed by permeabilization in 0.5% Triton X-100/PBS for 3 h at room temperature (20–25°C) and incubation with 2 µg ml-1 4′,6-diamino-2-phenylindole (DAPI; D9542, Sigma-Aldrich) for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... The growth medium of organoids was supplemented with 100μM with 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8-Br-cAMP) (Sigma, #B7880) in iPSC organoids or 200μM forskolin (FSK ...
-
bioRxiv - Biophysics 2022Quote: ... We dissolve 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methyl-morpholinium chloride (DMTMM) powder (Sigma Aldrich) in HEPES buffer (pH 7.18 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the coupling reagent 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium (DMTMM) chloride (Sigma-Aldrich). Stock solutions were prepared in phosphate-buffered saline at concentrations of 140 mM (PDH ...
-
bioRxiv - Cancer Biology 2021Quote: ... HCECs were grown in a hypoxia chamber with 2% O2 and 5% CO2 at 37°C in 4 parts DMEM to 1 part medium 199 (Sigma-Aldrich #M4530) with 2% cosmic calf serum (GE Healthcare) ...
-
bioRxiv - Neuroscience 2020Quote: ... the eluate was washed 3 times with PBS in an Amicon Ultra-4 Centrifugal Filter Unit (NMWL 3 kDa, Millipore, UFC800324) and finally concentrated to < 250 µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/mL interleukin-4 (IL-4, Sigma-Aldrich) and 0.5 μg/mL anti-CD180 (BD PharMingen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), Tim23 (BD Transduction Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), HSP60 [LK1] (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, San Louis, MI, USA) solution in PBS was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were incubated with 5 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma Aldrich) in PBS for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was applied to the cells and incubated for an additional 4h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... media was aspirated from cells and replaced with 5 mg/mL 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, #M5655, Sigma Aldrich) solution in base media ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... Fixed embryos were washed 3 times (5 minutes each) in wash buffer DPBS Tween containing 2% BSA (Sigma, A3311), and permeabilised at room temperature for 20 minutes in permeabilisation buffer 0.5% Triton-X in DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: Culture medium was replaced with 100 µL medium containing 5 mg/mL filtered 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (#M5655, Sigma-Aldrich) and incubated for 2 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 30 μL of MTT [(3- [4,5-dimethyl-2-thiazolyl] -2,5-diphenyl-2H-tetrazolium bromide; 5 mg/mL; (Sigma-Aldrich)] was added in each well and the plate incubated for 3 hours at 25°C ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking of endogenous peroxidases (3% H2O2) and unspecific antibody binding (2% BSA+5%serum) PLAC8 antibody (HPA040465, Sigma) or SARS-CoV-2 Spike Glycoprotein S1 antibody (GTX632604 ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were counterstained with 5 μM 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, Cat# D9542) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for 5 min with 10 μg/ml 4’,6-Diamidino-2-phenylindole (DAPI; Sigma-Aldrich) to stain cell nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... (F/+) or (F/F)) mice were administered 2 mg/mL doxycycline hyclate (Sigma-Aldrich #D9891) in their drinking water at 10-12 weeks of age ...