Labshake search
Citations for Millipore Sigma :
8401 - 8450 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2019Quote: ... a cell-permeant NO scavenger 2-(4-car-boxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO) (Sigma) at a high concentration of 500 μM was included ...
-
bioRxiv - Neuroscience 2019Quote: ... After two 15-minute washes with PBT (PBS with 1% or 3% Triton X-100; Sigma-Aldrich), the brains were blocked with 5% normal goat serum (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Biochemistry 2019Quote: ... 3 µl 16 mM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (Sigma-Aldrich) prepared in 20% DMSO and 80% t-butanol (Sigma) ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were incubated for 3 min in the same buffer containing 0.025% (w/v) DAB (Sigma-Aldrich) and 0.005% (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... 600 μl 4% acetic acid with 20 μl 1mM phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX, Sigma) and 0.6 μl 1mM spike control 8-Br-2′,3′-cAMP (Biolog ...
-
bioRxiv - Molecular Biology 2020Quote: ... per sample were washed 3 times with PBS/BSA (PBS with 5 mg/ml BSA (Sigma Aldrich)) ...
-
bioRxiv - Neuroscience 2021Quote: ... Incisions were made to expose the skull and then thoroughly cleaned with hydrogen peroxide (3%, Sigma-Aldrich), ethanol ...
-
bioRxiv - Neuroscience 2020Quote: ... (2E,4E)-2,4-octadienal (hereafter OCT) and (1S)-3-carene (hereafter CAR) were purchased from Sigma Aldrich, isopropyl cinnamate (hereafter IPC ...
-
bioRxiv - Cell Biology 2020Quote: ... The Golgi ribbon was disassembled into single stacks by treatment with 3 μg/ml nocodazole (EMD Millipore) for 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Coverslips were washed 3 times for 5 min then incubated with secondary antibodies and Hoechst 33258 (Sigma) for 1 hour at room temperature and again washed ...
-
bioRxiv - Microbiology 2019Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide was dissolved in Dulbecco’s PBS (-) (Sigma-Aldrich, India) (pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... Calu-3 (human epithelial lung adenocarcinoma) cells were cultured in Minimum Essential Medium Eagle (MEM, Sigma #M4655) supplemented with 10% FCS ...
-
bioRxiv - Microbiology 2021Quote: Full-length CA sequences derived from pNL4-3 was introduced to pET30a vectors (Novagen-Merck KGaA, Germany), producing a pET30a CA vector ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes were cultured alone in T cell media supplemented with 3-5 μg/ml ConA (Sigma Aldrich) or together with collagen matrices of 1 mg/ml or 4 mg/ml collagen without any embedded RAW 264.7 macrophages ...
-
bioRxiv - Genetics 2020Quote: ... Filtered FBS was made by passing through a 3 kD cut-off filter with centrifugation (Millipore, UFC9003). Heat-inactivated FBS was made by boiling the 3 kD filtered FBS at 95oC for 10 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... For ethanol precipitation 1/10 the volume of 3 M sodium acetate (pH 5.2) (Sigma-Aldrich Co.), 1 µl of glycogen (Thermo Scientific Co. ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM phosphoenolpyruvate (PEP) (Molecula, 16921512) and 16 units/ml lactic dehydrogenase/pyruvate kinase enzymes (Sigma, P0294). 30 mL reactions were prepared in 384 well plates (Greiner ...
-
bioRxiv - Immunology 2020Quote: Cell pellets from 3 hour monocyte co-cultures were harvested and lysed with RIPA buffer (Sigma-Aldrich) supplemented with protease and phosphatase inhibitors (Cell Signalling ...
-
bioRxiv - Synthetic Biology 2020Quote: Synthetic lipid 1,2-di-O-phytanyl-sn-glycero-3-phosphocholine (Avanti) was diluted in tridecane (Sigma-Aldrich) to a final concentration of 15 mg/mL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the fish were immersed in fresh buffered Tricaine (3-amino benzoic acid ethyl ester; Sigma A-5040) diluted in system water (0.016%w/v ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were blocked with 3% BSA and incubated with mouse anti-EBV-EAD (1:250, Millipore) and rabbit anti-YTHDF2 (1:250 ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 3 hours before addition of 30 μL of the bacterial growth reporter MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (2.5 mg/mL) (Sigma) and Tween 80 (10% ...
-
bioRxiv - Systems Biology 2019Quote: ... Six oligos for Fgf21 and 3 oligos for Lss (Sigma-Aldrich, St. Louis, MO; Supplementary Table 1) were tested ...
-
bioRxiv - Plant Biology 2019Quote: ... or H2O as a control and an equal volume of H2O containing 10 mM 3-MA (Sigma) for inhibition of autophagy ...
-
bioRxiv - Genetics 2020Quote: ... membranes were washed 3 times for 10 minutes at room temperature with 0.1% Tween 20 (Sigma-Aldrich) in 1X TBS ...
-
bioRxiv - Biochemistry 2020Quote: ... phosphatidyl-choline (2-oleoyl-1-palmityl-sn-glycero-3-phosphocholine) were from Sigma-Aldrich (St. Louis, MO); Ezetimibe and lysophosphatidylcholine (1-palmitoyl-sn-glycero-3-phosphocholine ...
-
bioRxiv - Cell Biology 2020Quote: ... Blots were also probed with rabbit anti-Na+/K+ ATPase α-3 antibody (Millipore Sigma, 1:1000) and rabbit anti-tubulin (Cell signaling ...
-
bioRxiv - Genomics 2021Quote: ... after which the supernatant was replaced by 50 μL of dispase (3 mg/mL, Sigma-Aldrich_D4818-2mg), 75 μl collagenase I (100 mg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... pH 4.46) was prepared by infusing 3 g of leaves with 0.1 g ascorbic acid (Sigma Aldrich) for 4 min in 300 ml freshly boiled water under gentle movement ...
-
bioRxiv - Biochemistry 2021Quote: ... Sodium azide (NaN3) and 3-(trimethylsilyl) propionate-2,2,3,3-d4 sodium salt (TSP) were obtained from Sigma-Aldrich, United Kingdom ...
-
bioRxiv - Neuroscience 2021Quote: ... 10-week-old animals were given 3 daily intraperitoneal injections of 50 mg/kg bromodeoxyruidine (BrdU; Sigma) and perfused 28 days later ...
-
bioRxiv - Cell Biology 2019Quote: ... After fixation cells were washed 3 times with PBS and quenched using 1% NaBH4 (Sigma, 452882-25G) solution (in PBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Phosphopeptide standards (0.1 pmol of MS PhosphoMix 1, 2, 3 Light; Sigma-Aldrich, St. Louis, Missouri, USA) was added to suspended sample in binding/equilibration buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 μL of 1× ligand (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Sigma-Aldrich) 20% DMSO in t-butanol) ...
-
bioRxiv - Biochemistry 2021Quote: ... coli polar lipids (Avanti, US) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Sigma Aldrich) in a 3:1 molar ratio ...
-
bioRxiv - Biochemistry 2021Quote: ... Adenosine 3′-phosphate 5′-phosphosulfate lithium salt hydrate (PAPS) and the antibiotics were purchased from Sigma-Aldrich Co ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... and transferred onto a round 25 mm coverslip previously coated with 3-(trimethoxysilyl) propyl methacrylate (Sigma-Aldrich). Medium was then replaced with 10% PEG-DA hydrogel solution (esibio ...
-
bioRxiv - Physiology 2021Quote: ... 1M MgSO4)) in a 3 μL drop of M9 containing 25 mM sodium azide (NaN3, Sigma-Aldrich). Images were acquired using a Leica TCS SP8 STED 3X confocal microscope at 63x ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Cell Biology 2020Quote: ... Subsequently 3 mL of 100 μM istaroxime (MedCham Exptress, Lot#11394) or ouabain (Sigma-Aldrich, Lot#BCBZ9329) in E3-MS-222 solution was added ...
-
bioRxiv - Bioengineering 2020Quote: ... Zebrafish were sacrificed with a lethal dose of MS-222 (Ethyl 3-aminobenzoate methanesulfonate) (Sigma-Aldrich, UK), followed by washing with 0.5% sodium hypo chloride or bleach (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: Mid-L2 Larvae were transferred to fresh medium containing 3 mg/ml chloroquine (Sigma-Aldrich Cat. # C6628) and 0.3% Erioglaucine disodium (Sigma-Aldrich Cat ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial suspensions were then diluted 1:3 in PBS and incubated with 1μM all-trans retinol (Sigma) for 3 hr in a 24-well plate at 37’C with gentle shaking at 120 rpm under light-restricted conditions ...
-
bioRxiv - Immunology 2020Quote: Adult zebrafish were euthanized with 200 – 300 mg/L of ethyl 3-aminobenzoate methanesulfonate (tricaine) (Sigma, E10521) prior to dissection ...