Labshake search
Citations for Millipore Sigma :
8301 - 8350 of 10000+ citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 6 μg of female-derived competitive DNA and 50 µg of sonicated salmon sperm DNA (Sigma-Aldrich). Each ethanol-precipitated probe mixture was dissolved in 20 μL of the hybridization buffer (for composition ...
-
bioRxiv - Cancer Biology 2022Quote: ... A methylcellulose stock solution was prepared by dissolving 6 grams of autoclaved methylcellulose powder (M0512 Sigma-Aldrich) into 250 ml of preheated (60°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 weeks old mice in the 4NQO group were given 100ug/ml of 4NQO (Sigma-Aldrich, #N8141), a water soluble chemical carcinogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... native fluorescence was quenched after immunostaining by overnight incubation with methanol containing 6% hydrogen peroxide (H1009, Sigma) at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... adult (6-8-wk-old) Lrig1-CreERT2/+;Apc-flox/+ mice were intraperitoneal-injected with 2mg tamoxifen (Sigma) in corn oil for 3 consecutive days ...
-
bioRxiv - Systems Biology 2019Quote: ... Slides were dried for 6 min and subsequently incubated at room temperature with Wright stain (Sigma-Aldrich) for 8 mins ...
-
bioRxiv - Bioengineering 2020Quote: ... as-synthesized mesoporous silica nanoparticles (AMS-6) were loaded with 20% Dox (Doxorubicin hydrochloride, #D1515, Sigma-Aldrich). Dox diluted in 100% ethanol was added to AMS-6 nanoparticles in a round bottom flask mounted on a rotary evaporator ...
-
bioRxiv - Bioengineering 2020Quote: ... the glass fiber capture membrane was submerged for 6-8 hours in trifluoroacetic acid (TFA, Sigma-Aldrich), and dried at room temperature overnight before assembly ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6-7-week-old female mice were injected intraperitoneally with 1 mg of Tamoxifen (T5648, Sigma-Aldrich) on three consecutive days ...
-
bioRxiv - Bioengineering 2020Quote: ... FMN was added in excess (above its solubility limit) (F6750, Sigma-Aldrich: 70% pure, free RbF ≤ 6%) and samples were incubated on ice for at least 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... and zanamivir ((2R,3R,4S)-3-acetamido-4-(diaminomethylideneamino)-2-[(1R,2R)-1,2,3-trihydroxypropyl]-3,4-dihydro-2H-pyran-6-carboxylic acid) were purchased from Sigma, NN-DNJ from Toronto Biochemicals ...
-
bioRxiv - Pathology 2020Quote: ... We used primary mouse monoclonal antibodies against anti-α-acetylated tubulin (clone 6-11B-1, Sigma Aldrich and proliferating cell nuclear antigen (PCNA ...
-
bioRxiv - Microbiology 2021Quote: ... A549 (ATCC) or HeLa (ATCC) cells were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Trichloroethylene (CAS Number 79-01-6) and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise noted ...
-
bioRxiv - Neuroscience 2020Quote: ... Hamilton syringes with 33 gauge needles were used to deliver 2 µL of 6-OHDA (Sigma-Aldrich, France ...
-
bioRxiv - Neuroscience 2019Quote: Samples were incubated in a blocking solution of 10% DMSO/6% donkey serum (EMD Millipore, Temecula, CA)/0.2% Triton X-100/PBS at 37 °C for 2-3 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... They were then washed and permeabilized 6 x 5mins in PBSTx (PBS plus 0.5% Triton-X (Sigma)) and blocked for 2 hrs room temperature in PBSTx plus 5% goat serum (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... vibratome sections (500 µm) from wild-type (C57BL/6) lungs were stained with rabbit anti-SftpC (Millipore) and Armenian hamster anti-Muc1 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... UFM1 (GCTGTGAAAGGTGTACTTTC) and UFC1 (GTGACAACGATTGGTTCCGAC) followed by selection with 75 µg/ml 6-thioguanine (Sigma-Aldrich, A4882) 4 days after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 6-day-old perithecia with TRI Reagent (Sigma-Aldrich, cat. no. T9424) and re-suspended in 5M urea ...
-
bioRxiv - Immunology 2020Quote: ... T cells were also stimulated for 6 hours with 50ng/ml PMA and 1μg/ml Ionomycin (Sigma). T cells were then harvested ...
-
bioRxiv - Molecular Biology 2021Quote: Melanoma cells treated with ARN22089 for 6 or 24 h and lysed in RIPA buffer (EMD Millipore or an optimized cocktail (250 mM NaCL ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the embryos were treated for 6 days with 0.003% N-phenylthiourea (PTU) (Sigma, St Louis, MO) to inhibit pigment formation.
-
bioRxiv - Genetics 2020Quote: ... HUT 78 cells were treated up to 6 hours with 1 μM of romidepsin (Sigma-Aldrich, SML1175), DMSO being used as a control ...
-
bioRxiv - Genetics 2020Quote: ... cells were permeablised first with 1ml/well (6-well plate) mTESR1 medium with 8μg/ml polybrene (Millipore) for 15 min (37°C) ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 g (±5 g) female C57BL/6 mice were injected intraperitoneally (I.P) with LPS (L-5886, Sigma). EVs were I.V injected via the tail vein subsequent to LPS induction and the animals were observed and weighed daily after induction ...
-
bioRxiv - Immunology 2022Quote: ... and digested in 6 ml of 2-mg/mL type II collagenase (Sigma # C6885 or Worthington #LS004177) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5 μg TRC2-pLKO-puro vector encoding shRNA (TRCN0000377256-NM_005871.3-637s21c1, designated here as shSMNDC1-6, or TRCN0000369078-NM_005871.3-724s21c1, designated here as shSMNDC1-7, Sigma) targeting different sequences of SMNDC1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Successfully transduced cells were then selected using blasticidin (6 µg/ml, Cat. no. 15205, Sigma-Al- drich). For the experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... fibroblasts were seeded at 2.25×104 into each well of 6 well dishes (Millipore Sigma Cat. CLS3516) in 2ml complete M106 on Day 0 and grown overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 μg of RNA replicons were transfected into 105 fibroblasts on 6-well plates using RiboJuice (Sigma) in the presence of 100 ng/ml B18R (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... Adult mice (7 week old) mice were injected with 6 mg of Tamoxifen in Corn Oil (Sigma) intraperitoneally for 3 days ...
-
bioRxiv - Genetics 2022Quote: ... UMOD-GFP cells were treated for 6 h with 2.5 μM proteasome inhibitor MG132 (M8699, Sigma-Aldrich). Protein samples were collected at 2 ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... the barcode beads were washed three times in 6 x SSC buffer (Sigma, catalog no. S0902-1L) and loaded into Countess (Thermo-Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 weeks aged mice were fed with drinking water containing 50 μg/mL 4NQO (Sigma-Aldrich, N8141) for 16 weeks and then given normal drinking water for additional 10 weeks ...
-
bioRxiv - Neuroscience 2023Quote: ... confluent wells in a 6-well plate were incubated with 20mM NH4Cl (Sigma-Aldrich, St Louis MO) and 300μM leupeptin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-week- old male mice were injected with 25 mg/kg LPS (Sigma Aldrich, St. Louis, MO) or PBS above calvariae ...
-
bioRxiv - Physiology 2024Quote: ... hypothalamic tissue was homogenized in 100% methanol containing 1 mM 6-propyl-2-thiouracil (PTU) (Sigma, H34203) in a glass-glass tissue grind pestle (60mm ...
-
bioRxiv - Bioengineering 2024Quote: ... mice at 6 to 8 weeks of age were conditioned with busulfan (Sigma, St. Louis, MO, USA) injected intraperitoneally (25 mg/kg body weight/day ...
-
bioRxiv - Neuroscience 2024Quote: ... EAE was induced in C57BL/6 mice by immunization with oligodendrocyte glycoprotein 35–55 (200 μg; Sigma) in incomplete Freund’s adjuvant supplemented with Mycobacterium tuberculosis H37Ra ...
-
bioRxiv - Neuroscience 2024Quote: ... vibratome sections were counterstained with 1:1000 DAPI (4ʹ,6-diamidino-2-phenylindole, 1 mg/ml, Sigma) in PBS and incubated for 20 minutes in the dark ...
-
bioRxiv - Genomics 2024Quote: ... Samples were incubated with primary antibodies (mouse anti-acetyl-alpha tubulin antibody, clone 6-11B-1 [Millipore-Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by 6 PBSTx washes and incubation with anti-DIG antibody (1:1,500; CAT 11207733910; Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... The primary antibodies mouse anti-acetylated α-tubulin (clone 6-11B-1, Merk-Sigma, #MABT868, 1:800), mouse beta-tubulin (E7 ...
-
bioRxiv - Immunology 2024Quote: ... 6-FP was washed off and the cells treated with 50 μg/ml Brefeldin A (BFA, Sigma) or the equivalent volume of DMSO (Sigma ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All medium for microfluidic experiments contained 20mg/L Pluronic F127 surfactant (CAS 9003-11-6, Sigma-Aldrich).
-
bioRxiv - Systems Biology 2022Quote: ... Shapes were then re-suspended in 6 μL of 80 mM triethylammonium bicarbonate buffer (pH 8.5, Sigma) with 0.013% dodecyl-β-D-maltoside (DDM ...
-
bioRxiv - Cell Biology 2023Quote: ... at density .5×106 cells / 6-well plate coated with gelatin (Millipore, cat. no. ES-006-B). Cells were cultured in basic culture media (described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then 0.2 mL of washed IgG Sepharose 6 Fast Flow beads (Millipore Sigma, Cat#: GE17-0969-01) were added to each sample and incubated on a rotisserie mixer for 0.5 h at room temperature ...