Labshake search
Citations for Millipore Sigma :
8251 - 8300 of 10000+ citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Lymph nodes were harvested and fixed in 4% Paraformaldehyde (Sigma) for 8 hours at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... propranolol (#4199-10-4, Sigma Aldrich, St. Louis, MO, USA), a β1/2 receptor antagonist ...
-
bioRxiv - Bioengineering 2024Quote: ... coverslips were mounted using Mowiol® 4-88 (Sigma-Aldrich) and imaged on a Leica SP8 confocal microscope with a HC PL APO 63x/1.40 OIL CS2 objective (all Leica Microsystems ...
-
bioRxiv - Bioengineering 2024Quote: ... using Amicon Ultra 4 mL centrifugal filters (Millipore, Etobicoke, Canada). ITC experiments were performed on a TA Instruments Affinity ITC instrument ...
-
bioRxiv - Developmental Biology 2024Quote: ... carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP, Sigma, cat. no. C2920); 6-aminonicotinamide (6-AN ...
-
bioRxiv - Neuroscience 2024Quote: ... The cultures were embedded in Mowiol 4-88 (Sigma-Aldrich), after which confocal imaging was performed with a Zeiss LSM700 and Zeiss LSM800 confocal microscope using ZEN software (Zeiss ...
-
bioRxiv - Neuroscience 2024Quote: ... DOI [(±)-2,5-dimethoxy-4-iodoamphetamine] (Sigma Aldrich, St. Louis, MO) and LPH-528 were dissolved in sterile 0.9% saline solution (Fresenius lab ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-nitrophenyl-phosphorylcholine and Triton X-100 were from Sigma (now Merck Life Sciences ...
-
bioRxiv - Microbiology 2024Quote: ... 4 mL of a 0.5 mM HAuCl solution (Sigma-Aldrich) was brought to a boil ...
-
bioRxiv - Microbiology 2024Quote: ... and a section was suspended in 4% paraformaldehyde (PFA) (Sigma) for histopathological analysis by pathologists in a blinded manner according to previously described score guidelines [21] ...
-
bioRxiv - Cell Biology 2024Quote: ... and keratinocyte colonies were fixed in 4% paraformaldehyde (Sigma, 158127) for 10 min then stained with 1% Rhodanile Blue (1:1 mixture of Rhodamine B (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... fish were fixed with 4% formaldehyde (Sigma-Aldrich, USA, #158127) diluted in 1X PBS for 2h at RT ...
-
bioRxiv - Molecular Biology 2024Quote: Antibody against PPARα (Merck Millipore MAB3890, 4 µg per sample) was conjugated to magnetic beads (Sera-Mag ...
-
bioRxiv - Microbiology 2020Quote: ... cells were fixed with formaldehyde/PBS solution (6%) and stained with crystal violet (1%; Sigma Chemical Corp.) in 70% methanol ...
-
bioRxiv - Biophysics 2021Quote: ... PS-CI was reduced or oxidised with substoichiometric amounts of sodium dithionite or K3Fe(CN)6 (Sigma) under anaerobic conditions in an electrochemical glass cell equipped with a 4°C water bath ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were loaded into 6% or 10% SDS-PAGE gels and stained with Coomassie Brilliant Blue (SIGMA) (5 µl from the eluate ...
-
bioRxiv - Immunology 2021Quote: ... after LPS-priming macrophages were treated for 6 h in OptiMEM with 1.5 µM nigericin (Sigma-Aldrich) or 1 µg/ml Clostridium difficile toxin B (Enzo Life Sciences ...
-
bioRxiv - Genetics 2021Quote: ... cells underwent negative selection for 6 days with 1 ug/mL doxycycline (to induce promoter expression; Sigma), 100 ug/mL blasticidin S (to kill cells not expressing the blasticidin-resistant plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... the leaves were harvested and treated with 0.5 mg/ml DAPI (4ʹ,6-diamidino-2-phenylindole; Sigma). A Zeiss LSM 510 confocal scanning microscope was used to collect images.
-
bioRxiv - Microbiology 2020Quote: ... cells were fixed with formaldehyde/PBS solution (6%) and stained with crystal violet (1%; Sigma Chemical Corp.) in 70% methanol ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from 2-week-old seedlings or 6-week-old plants using Trizol (Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... electroporated parasites were mixed with 100μl of reticulocyte-rich blood from a phenylhydrazine (6 mg/ml, Sigma) treated ...
-
bioRxiv - Developmental Biology 2022Quote: ... The IL-6 inhibitors LMT-28 and the Wnt/β-catenin inhibitor IWR-1 (I0161, SIGMA-ALDRICH) were both used at 10 μM.
-
bioRxiv - Immunology 2022Quote: 6 x 105 cells were added into the wells of a 96 well filter plate (MSHVS4510 Millipore MultiScreenHTS HV Filter Plate ...
-
bioRxiv - Biochemistry 2019Quote: ... Labeled viruses were further purified by ultracentrifugation at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient for 1 hour.
-
bioRxiv - Microbiology 2019Quote: ... Cells were prepared in 6-well plates precoated with laminin (10 mg/ml; catalog number L2020; Sigma) and were grown to near confluence (80 to 90% ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were incubated 45 min at 37 °C with 0.6 mg.mL−1 fructose-6-phosphate (Sigma) and 0.6 mg.mL−1 glutamine (Sigma) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and used to transduce cells in the presence of 6 μg/mL polybrene (Sigma, St. Louis, MO).
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated into 6 well plates coated with >300,000 MW Poly D Lysine (PDL; Sigma, P7405). After 7 DIV ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-Glutamine Synthetase (for Müller glia-specific marker; 1:5000 Millipore #MAB302, clone GS-6); goat polyclonal anti-Brn3a (for retinal ganglion cell marker ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were stripped by two 7 min incubations in stripping buffer (6 M guanidine hydrochloride (Sigma: G3272) with 1:150 β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... The biotinylation reaction was quenched by 3 washes of a stop solution prepared with 10 mM 6-Hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Sigma), 20 mM sodium Ascorbate and 10 μM sodium azide in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 300 μl of the supernatant was mixed 1:1 with 6% (w/v) sulfosalicylic acid (Sigma-Aldrich) in milliQ water ...
-
bioRxiv - Cell Biology 2021Quote: NFIC expression was interfered in 266-6 cells using Mission shRNA lentiviral constructs purchased from Sigma-Aldrich. Nfic sh1 [TRCN0000374154 targeting ACAGACAGCCTCCACCTACTT) ...
-
bioRxiv - Genomics 2021Quote: ... we harvested EBs and moved them to an ultra-low attachment 6-well plate (CLS3471-24EA, Sigma) in E6 media (A1516401 ...
-
bioRxiv - Microbiology 2019Quote: ... For each strain 60 µl lysate were incubated with 6 µl amyloglucosidase (200 U/ml, Sigma-Aldrich) (quantification of glucose stored as glycogen and free glucose ...
-
bioRxiv - Molecular Biology 2021Quote: ... Culture medium was changed 6 h after transfection and supplemented with 10 μM 9-cis-retinal (Sigma) for experiments with light-activated receptors ...
-
bioRxiv - Molecular Biology 2021Quote: ... Culture medium was changed 6 h after transfection and supplemented with 10 μM 9-cis-retinal (Sigma) for experiments with light-activated receptors.
-
bioRxiv - Neuroscience 2020Quote: ... followed by 6×10 min washes in PBX (PBS with 0.3% Triton-X 100 [Sigma-Aldrich, T8787]) at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 wells) in 1 ml of media in 24-well plates coated with poly-HEMA (Sigma P3932) to inhibit cell adherence ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen retrieval was performed by microwaving sections in preheated 0.01 M citrate buffer pH 6 (Sigma Aldrich) for 5 min.
-
bioRxiv - Cell Biology 2020Quote: ... Islets were isolated from 6-12 week old male and female FVB mice using collagenase XI (Sigma) digestion according to a previously published protocol101 ...
-
bioRxiv - Biophysics 2022Quote: ... (6)) by using anti-Flag coupled beads (Pierce, #A36797) for Src precipitation and anti-Flag (M2, Sigma) and anti-Myc (9B11 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse monoclonal antibodies: anti-acetylated α-tubulin (AcTub) (Sigma, T7451, clone 6-11B-1, IF: 1:10,000), anti-α-tubulin (Proteintech ...
-
bioRxiv - Immunology 2022Quote: ... as the mobile phase on the Superose 6 Increase 10/300 GL (Millipore Sigma, 29-0915-96). Fractions were analyzed by SDS-PAGE to identify those containing gH/gL >95% purity based on Coomassie blue staining ...
-
bioRxiv - Cell Biology 2022Quote: ... contained in a 6-well plate were coated with poly-D-lysine (50 ng/ml, Sigma, P6407) for 1-2 h at 37°C after which the poly-D-lysine was removed ...
-
bioRxiv - Developmental Biology 2022Quote: ... a mouse monoclonal anti-acetylated tubulin clone 6-11B-1 antibody (IgG2b; product T 6793; Sigma-Aldrich) were used at 1:2,500 dilution and secondary anti-mouse isotype-specific antibody conjugated with Alexa 488 (anti-IgG2b ...
-
bioRxiv - Developmental Biology 2021Quote: ... then dehydrated through a PBS/methanol gradient and bleached with 6% (vol/vol) hydrogen peroxide (H1009, Sigma) in methanol overnight at 4° C ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded in 6-well plate (100,000 to 150,000) and infected in the presence of 8μg/ml polybrene (Sigma). Cells were selected in medium containing 3μg/ml puromycin (Sigma ...
-
bioRxiv - Biophysics 2020Quote: Unsized unilamellar DOPG liposomes containing Laurdan (6-Dodecanoyl-N, N-dimethyl-2-naphthylamine, from Sigma, Taufkirchen, Germany) (molar ratio lipid:Laurdan=1:500 ...