Labshake search
Citations for Millipore Sigma :
8051 - 8100 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 18 μL (1:3 ratio of DNA to transfection reagent) of X-tremeGENE™ 9 DNA transfection reagent (MilliPore Sigma). The mixture was incubated for 30 mins at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... or 1000 nM of 2-(4-amino-1-isopropyl-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-1H-indol-5-ol (PP242; Sigma, P0037), (2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were concentrated by centrifugation at room temperature and seeded to derive respective primary cell cultures in MEM medium with 3% FBS (Sigma). The primary cell cultures were transduced with the fluorescent td tomato-/EGFP-luciferase fusion protein expressing lentiviral vectors for 18-24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... pH 8) containing 3 mg/ml lysozyme (Chicken egg white; Fluka) and 1 mg/ml lipase (from Candida cylindracea; Sigma) in an Eppendorf tube ...
-
bioRxiv - Microbiology 2019Quote: ... rinsed worms were treated for 20 minutes with 100µL of a solution of SDS + DTT (WB + 0.25% v/v sodium dodecyl sulfate + 3% v/v dithiothreitol [1M, freshly mixed in water], chemicals from Sigma Aldrich) to partially disrupt the cuticle ...
-
bioRxiv - Biophysics 2019Quote: ... The pellet was resuspended in HB and loaded onto a three-step Percoll gradient (3%, 10%, and 23%; Sigma-Aldrich) in HB without protease inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2019Quote: ... determined by DpnII-qPCR assays as previously described 3 To reduce the background methylation levels in the presence of 1.0 mM IAA (Sigma, I5148), we transduced the selected clones of both AID-Dam-LmnB1 and Dam-only with extra hPGK-Tir1-puro followed by selection with 0.8 µg/mL puromycin ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with antibodies (5-8 μg) overnight at 4°C followed by incubation for 3 hours with protein G-sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Genetics 2020Quote: ... and precipitated with antibodies overnight at 4°C followed by incubation for 3 h with protein G Sepharose beads (Millipore). Normal mouse ...
-
bioRxiv - Cell Biology 2019Quote: ... Fixed cells were stained with the following antibodies (for 3 hrs at 37°C): β-Tubulin (1:100, Sigma-Aldrich), DBC1 (1:100 ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL of cells were transferred into 100 µL of staining solution (Phosphate Buffer Saline + 3 µM propidium iodide (Sigma) + 200nM YP (Invitrogen) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 ×106 cells were allocated per ChIP assay and prepared using the Magna ChIP A/G chromatin immunoprecipitation kit (Millipore). Cells were centrifuged (300g) ...
-
bioRxiv - Plant Biology 2020Quote: ... plants were incubated overnight at 37°C in GUS buffer (3 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide [Duchefa Biochemie, Haarlem, The Netherlands], 0.1% v/v Triton X-100 [Sigma, Steinhaim ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS and then incubated for 30 min with secondary antibodies and DAPI (Sigma, 1:1000 dilution); all antibodies were diluted in PBS + 3% BSA and are as follows ...
-
bioRxiv - Bioengineering 2019Quote: Cy3-(GT)6-SWCNTs and Cy3-(GT)30-SWCNTs were first filtered 3 times using 100kDa Amicon centrifuge filters (Millipore) to remove free Cy3-DNA from solution ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cytotoxic effect was assessed using in MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay (Sigma- Aldrich, USA).
-
bioRxiv - Bioengineering 2019Quote: ... Laccase activity was followed by the oxidation of 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) (Sigma-Aldrich, USA) (33) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Fixed whole-mount tissues were washed 3 times with PBS-Triton (0.1%) and blocked with 20% goat serum (Sigma G6767) for 1 hr ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were hydrated with H2O for 3 min at 37°C followed by treatment of the tissue with 0.5 mg/ml of Pepsin (Sigma-Aldrich) for 15 min at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... were added to 1 mL of 10 mg∙mL−1 of N-(3-dimethylaminopropyl)-N’-ethylcabodiimidie hydrochloride (EDC, Sigma-Aldrich) dissolved in 100 mM sodium phosphate ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein fractions were collected and concentrated using Amicon-Ultra 3- or 10-kDa molecular weight cut-off centrifugal spin filters (Millipore), then washed three times with HNC buffer to remove imidazole ...
-
bioRxiv - Cancer Biology 2019Quote: ... For cytokine analysis replicate wells were harvested on day +3 of co-culture and cytokine secretion determined via multiplex Luminex LiquiChip (Millipore).
-
bioRxiv - Biochemistry 2019Quote: ... 50ml fractions were collected and DJ-1/Hsp32-containing fractions (eluted after 150–200 ml) were concentrated using a 3-kDa Amicon Ultra column (Millipore). Concentrated DJ-1/Hsp32 was loaded onto a gel filtration column (Superdex 200 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were grown in M9 minimal media supplemented with glucose containing M9 salts (6.78 g/L Na2HPO4, 3 g/L KH2PO4, 1 g/L NH4Cl, 0.5 g/L NaCl) (Sigma-Aldrich, M6030), 0.34 g/L thiamine hydrochloride (Sigma T4625) ...
-
bioRxiv - Developmental Biology 2019Quote: ... with cardiac weight accounting for 0.5% of body weight) were anesthetised by immersion in system water containing 0.04% MS-222 (ethyl-3-aminobenzoate methanesulfonate salt; E10521; Sigma-Aldrich) for 3−5 min and then immobilized on a petri dish ...
-
bioRxiv - Neuroscience 2019Quote: ... The DNA (3–4 μg/μl) together with the dye Fast Green (0.3 mg/ml; Sigma, St Louis, MO, USA) was injected (~1 μl ...
-
bioRxiv - Bioengineering 2020Quote: ... the chips were silanized by immediately adding 0.5 ml of a fresh 1% aqueous solution of 3- (Ethoxydimethylsilyl) propylamine (Sigma, 588857) into the culturing chamber of the chip and incubated for 15 min at RT before rinsing with twice with 1 ml dH2O water ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The column used was a Supelco Supelcosil™ LC-18 column (15 cm × 4.6 mm, 3 μm; Sigma-Aldrich Co.). MD-TM Mobile Phase (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... and 1,2-diacyl-sn-glycero-3-phospho-L-serine mixture (PS mixture from bovine brain) was bought from Sigma-Aldrich, Dorset ...
-
bioRxiv - Physiology 2019Quote: ... cells were kept in 5 mM glucose containing DMEM medium for 3 hours followed by 1 hour in serum free EBSS (Cat. No # E2888, Sigma) prior to collection ...
-
bioRxiv - Microbiology 2020Quote: ... parahaemolyticus cells incubated in ASW microcosms at 4°C for 100 days were re-suspended in 50 mM potassium phosphate buffer (pH 7) containing 1 g of 3-mm-sized glass bead (Sigma), vortexed for 25 min ...
-
bioRxiv - Bioengineering 2020Quote: ... and spin-filtered to concentrate and remove impurities (14 krcf for 30 min; Amicon Ultra-0.5 mL centrifugal filters with 3 kDa MWCO, Millipore Sigma). Proteins were alkylated with 15 mM iodoacetamide for 30 min in the dark ...
-
bioRxiv - Bioengineering 2020Quote: ... CSF was concentrated 10X prior to the incubation step to maintain the same protein to nanoparticle ratios under volume constraints (14 krcf for 30 min; Amicon Ultra-0.5 mL centrifugal filters with 3 kDa MWCO, Millipore Sigma). The ratio of protein concentration to nanoparticle surface area was maintained constant for each respective nanoparticle type in different biofluids ...
-
bioRxiv - Physiology 2020Quote: ... ob-Acsl1H-/- and lean and obese Acsl1flox/flox littermate control mice were injected intraperitoneally with tamoxifen (3 mg/40 g of body weight) (Sigma) dissolved in corn oil (20 mg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... After washing 3–4 X with 1× PBS-T the strips were incubated with 1:5000 mouse anti-GST antibodies (Sigma). The secondary antibodies (anti-rabbit-HRP or anti-mouse-HRP ...
-
bioRxiv - Neuroscience 2019Quote: ... then blocked for 1 hour in PBS supplemented with 0.5% Triton X-100 and 3% normal Goat Serum (Sigma G9023). Slices were incubated at 4°C in primary antibody (diluted in blocking solution ...
-
bioRxiv - Developmental Biology 2019Quote: ... cell bodies of HUVECs cultured in Transwells were scraped off and remaining protrusions were exposed to 3 μM Puromycin (Sigma) added to lower chambers for 6 minutes ...
-
bioRxiv - Biochemistry 2019Quote: ... 3 mM KCl) and harvested in a PBS lysis buffer (PBS plus 6 uL/mL protease inhibitors cocktail (Sigma P8340), 0.6 mM PMSF ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 mg/mL X-Gal (5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside, Sigma Aldrich Aldrich, St. Louis, MO), and 150mM NaCl ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... SAG1.3 (3-Chloro-N-[trans-4-(methylamino)cyclohexyl]-N-[[3-(4-pyridinyl)phenyl]methyl]benzo[b]thiophene-2-carboxamide) was from Sigma. Cyclopamine-KAAD and SANT-1 ((4-Benzyl-piperazin-1-yl)-(3,5-dimethyl-1-phenyl-1H-pyrazol-4-ylmethylene)-amine ...
-
bioRxiv - Biochemistry 2019Quote: ... CsgA was concentrated to 1.8 mg/ml using a 3 kDa cut-off spin column at 4ºC (Amicon® Ultra-4, Sigma-Aldrich). The size exclusion chromatography (SEC ...
-
bioRxiv - Biochemistry 2021Quote: ... Tissues were processed and 3 μm deparaffinized sections were treated for 45 min with 0.5% (w/v) α-amylase (Sigma), rinsed for 30 min in water and processed for Periodic Acid Schiff (PAS ...
-
bioRxiv - Genetics 2021Quote: ... slides were incubated at room temperature for 10 min in 3% (v/v) stop/wash buffer (EMD Millipore; Part # 90419) to terminate the reaction and washed three times in 1× PBS for 5 min each ...
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 isolate nCoV-WA1-2020 (MN985325.1)11 (Vero passage 3) was kindly provided by CDC and propagated once in Vero E6 cells in DMEM (Sigma) supplemented with 2% fetal bovine serum (Gibco) ...
-
bioRxiv - Genomics 2021Quote: ... and sorting G1 cells based on Hoechst staining on a JAZZ FACS machine into 384 well plates containing 50 nl Wash buffer 3 (Wash buffer containing 0.05 % saponin) and 5 μl sterile filtered mineral oil (Sigma Aldrich) per well ...
-
bioRxiv - Genomics 2021Quote: ... into 384 well plates containing 50 nl Wash buffer 3 (Wash buffer containing 0.05 % Tween) and 5 μl sterile filtered mineral oil (Sigma Aldrich) per well ...
-
bioRxiv - Genetics 2020Quote: A 32P 5′-labeled 70-mer oligonucleotide [5′-42(T)-ATCTCAGCGATCTGTCTATTTCGTTCAT-3′] was hybridized to a single-stranded pBluescript SK(+) followed by one cycle of polymerization using KOD polymerase (Novagen) to produce a ∼3-kb double-stranded template with a preformed replication fork ...
-
bioRxiv - Biophysics 2021Quote: ... was also placed into 7 M Guanidium HCl using three successive concentrations and dilutions using a centrifugal concentrator (3 K MWCO, Amicon Ultra-4, Millipore), and diluted to 2 mg/mL ...
-
bioRxiv - Biophysics 2021Quote: ... Free dye was removed from the labeled proteins by successive concentrations and dilutions using a 3 K MWCO centrifugal concentrator (Amicon Ultra-4, Millipore). The labeling efficiency was computed by measuring the concentration of the protein and Cy3 dye using their absorbances at 280 nm and 550 nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentiviral vectors expressing the shRNA targeting PAT4 were produced as follows: HEK293T cells were co-transfected with shRNA-PAT4 plasmid DNA (5’-CCGGCCTTGATAAATGAGCAGAATTCTCGAGAATTCTGCTCATTTATCAAGGTTT TTG-3’; TRCN0000043984; Sigma) or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC ...