Labshake search
Citations for Millipore Sigma :
751 - 800 of 4279 citations for Recombinant Human ABHD15 His tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... and 500 U/mL recombinant leukemia inhibitory factor (LIF; Millipore, ESG1107) at 37 °C in 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Recombinant protein was produced in Escherichia coli strain BL21(DE3) (Novagen). The cells were grown in LB medium at 37°C and the protein expression was induced at OD600 of 0.7 with 0.2 mM IPTG (Isopropyl β-d-1-thiogalactopyranoside ...
-
bioRxiv - Biophysics 2022Quote: ... The recombinant proteins were first purified by Ni2+-affinity column (Novagen) under native conditions and subsequently in-gel cleavage by TEV protease was conducted ...
-
bioRxiv - Developmental Biology 2023Quote: ... 103 units/mL ESGRO recombinant mouse LIF protein (Millipore Sigma, ESG1107), 2 μM PD0325901 (Tocris ...
-
bioRxiv - Evolutionary Biology 2024Quote: All recombinant proteins were expressed using pET-11a (Sigma #69436-3) based vectors in BL21(DE3 ...
-
bioRxiv - Neuroscience 2024Quote: DNase activity in vitro test: Recombinant DNase I (DNase, Sigma-#4536282001) was diluted with pure water into different concentrations (0.01 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and DNAse-treated using recombinant DNAse I (Sigma-Aldrich, Cat#04716728001). 200 ng of total RNA was used for cDNA synthesis using the SuperScript IV First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... human Akt1 (Sigma-Aldrich) or 0.3 μg active ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified human ApoA1 (Sigma) or purified ApoA1-ApoM protein was resuspended in PBS (10:1 mol/mol ...
-
bioRxiv - Systems Biology 2020Quote: ... human (GluFib, Sigma Aldrich) was added (0.3 ng/µl ...
-
bioRxiv - Microbiology 2021Quote: ... Human HDL (Merck Millipore) was incubated with NS1 for 1 hour at 37°C prior to the DSC experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... human fibronectin (Sigma-Aldrich) 5 µg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... human serum (H2918, Sigma), DMXAA (D5817 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human IgG (Sigma), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... human insulin (I9278, Sigma), human TGFβ1 (PHP143B ...
-
bioRxiv - Cell Biology 2022Quote: ... or human fibronectin (Sigma). We found that BSA and collagen IV coating both resulted in reliable cell adhesion ...
-
bioRxiv - Immunology 2022Quote: ... Pooled human serum (Sigma) dilutions and pooled saliva were prepared in a 96-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma), Penicillin-Streptomycin ...
-
bioRxiv - Microbiology 2022Quote: Human fibrinogen (Millipore Sigma) was resuspended in PBS at 1 ng/μL ...
-
bioRxiv - Immunology 2022Quote: ... + 10% human serum (Sigma) + 2mM L-glutamine (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human fibrinogen (Sigma-Aldrich) labeled with fluorescent Alexa Fluor 647 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma) and 50% virus solution in RPMI media (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... Human AB serum (Sigma), recombinant IL-2 ...
-
bioRxiv - Cell Biology 2023Quote: ... human serum (H2918, Sigma), Zymosan (Z4250 ...
-
bioRxiv - Bioengineering 2024Quote: ... human laminin (Sigma-Aldrich) and polyethylene glycol diacrylate (PEGDA ...
-
bioRxiv - Cell Biology 2024Quote: ... Human AB serum (Sigma) was used to prepare unstimulated cells or FCS (Biosera or Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... with human fibronectin (Sigma) 10 μg/ml for 2h at room temperature under a laminar flow hood ...
-
bioRxiv - Biochemistry 2022Quote: ... human serum (Sigma-Aldrich), trypsin (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... human transferrin (#T8158, Sigma), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC #P0673) ...
-
bioRxiv - Immunology 2024Quote: Human AB serum (Millipore) was diluted 1/10 to a final volume of 200 mL in ice-cold PBS + 0.1% Tween 20 ...
-
bioRxiv - Biochemistry 2024Quote: ... human AC16 cells (Millipore) were cultured in DMEM/F12 supplemented with 10% FBS and either 6% D2O (heavy labeled population ...
-
bioRxiv - Cancer Biology 2024Quote: ... human insulin (Sigma # I0516) was added at a final concentration of 0.01mg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human E2F1 shRNA (Sigma): TAACTGCACTTTCGGCCCTTT ...
-
bioRxiv - Immunology 2021Quote: ... the His-tag was cleaved using a Thrombin kit (Millipore Sigma, St. Louis, MO). Confirmation of the His-tag removal was confirmed by W ...
-
bioRxiv - Microbiology 2021Quote: ... Cleared lysates were loaded on chromatographic columns filed with His-select resin (Millipore Sigma) or glutathione resin (GE healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... Ni-NTA pull down was conducted by using HIS-Select Nickel Affinity Gels (Sigma). After lysing cell pellet with buffer A (6 M guanidine-HCl ...
-
bioRxiv - Microbiology 2021Quote: ... Target proteins were bound to 1 mL Ni-NTA His-Bind resin (Millipore Sigma) in gravity columns ...
-
bioRxiv - Biochemistry 2020Quote: ... FphF protein was initially purified by Ni2+ affinity chromatography (HIS-Select resin, Sigma-Aldrich) using an elution buffer containing 50 mM Tris pH 8.0 ...
-
bioRxiv - Plant Biology 2021Quote: ... Western blotting was performed using anti His-tag (Cat no. H1029-5ML, Sigma, USA) as well as with anti GST antibody (Cat no ...
-
bioRxiv - Plant Biology 2020Quote: ... The pET-26-tNPR1-His plasmid was then transformed into Rosetta (DE3) pLysS (Novagen). The overnight culture at 37°C was transferred to fresh LB medium containing 50 μg/mL kanamycin and was incubated to OD600=1.0 at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and the supernatant was applied to a HIS-Select Nickel Affinity Gel column (Sigma) equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... and the supernatant was applied to a HIS-Select Nickel Affinity Gel column (Sigma) equilibrated in lysis buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary antibody (Anti-His; Invitrogen, Waltham, MA or Anti-HA; Sigma Aldrich, St.Louis, MO) was added to the blocking solution at 1:2,000 dilution and incubated overnight at 4 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... and the subsequent western blot analyses were performed with anti-His (Sigma, Missouri, USA) or anti-FLAG antibody (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% (v/v) HI-FBS and 1% (v/v) antibiotic/antimycotic (Sigma) in a standard tissue culture incubator at 37 °C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... A horseradish peroxidase-labeled anti-His tag antibody (1:25000 dilution; Sigma-Aldrich, Poland) diluted in 5% skimmed milk / TBS-Tween (0.1% ...
-
bioRxiv - Neuroscience 2020Quote: ... The His-tag was removed by O/N incubation with TEV protease (Millipore Sigma) at 4 °C followed by negative INAC ...
-
bioRxiv - Immunology 2020Quote: ... and loaded onto a cOmplete™ His-Tag Purification Resin gravity column (Sigma Millipore). Resin was first washed with detergent-containing buffer (25 mM Tris + 500 mM NaCl + 0.5 % N-Dodecyl-β-D-maltoside ...
-
bioRxiv - Immunology 2022Quote: ... The lysate was mixed gently with 50% Ni-NTA His-bind slurry (EMD Millipore) at 4:1 ratio on a shaking platform for 60 minutes at RT ...
-
bioRxiv - Microbiology 2020Quote: ... Protein expression was validated by microarray using monoclonal anti-polyhistidine (clone His-1, Sigma).