Labshake search
Citations for Millipore Sigma :
7851 - 7900 of 10000+ citations for Rabbit Anti Human IgG+IgM+IgA Alexa Fluor 660 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Cancer Biology 2023Quote: ... human epidermal growth factor (EGF, 20 ng ml−1; Sigma-Aldrich, E9644), human fibroblast growth factor (FGF ...
-
bioRxiv - Cell Biology 2023Quote: ... the epididymal sperm were incubated in human tubular fluid (HTF; EMD Millipore) at 2.0 x 106 cells/ml concentration for 90 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Epidermal Growth Factor (hEGF, Cat# 62253-63-8, Sigma-Aldrich, USA), human Transforming Growth Factor-α (hTGF-α ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with human epidermal growth factor (hEGF) (20 ng/ml, Sigma E9644) and human fibroblast growth factor 2 (hFGF2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Transforming Growth Factor-β1 (hTGF-β1, Cat# T7039, Sigma-Aldrich, USA), Fibroblast Growth Factor 1 (FGF1 ...
-
bioRxiv - Genetics 2023Quote: ... Human ESCs were lysed with 50-100 µL of RIPA buffer (Sigma) supplemented with 1x Complete EDTA-free Protease Inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Human interferon-β recombinant protein was purchased from Millipore (St. Louis, MO), and for stimulation ...
-
bioRxiv - Immunology 2023Quote: ... the patterned surface was coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water for 1 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... single stranded DNA (ssDNA, prepared from dsDNA) and human insulin (Sigma, I9278) by ELISA as described (Gitlin et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC0813 medium was supplemented with 10units/mL human recombinant insulin (Sigma-Aldrich), and MHHNB11 medium was supplemented with MEM Non-Essential Amino Acids (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: Human neutrophils were isolated by layering whole blood over Histopaque-1119 (Sigma) followed by a discontinuous Percoll gradient (Amersham Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 1µg 13C and 15N labelled human Apolipoprotein (Apo-1) (Sigma) as a known standard to 50µg total mycelial extract to assess the variance during sample preparation and measurements ...
-
bioRxiv - Immunology 2022Quote: Human 38-plex magnetic cytokine/chemokine kits (EMD Millipore, HCYTMAG-60K-PX38) were used per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Human LDL (hLDL) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Fluorescein isothiocyanate (FITC)-conjugated anti-CD41 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 12µL human insulin (final concentration 2.375-2.875µg/mL, Sigma Aldrich I9278) were added to make SXO HPLM ...
-
bioRxiv - Cell Biology 2023Quote: ... pre-coated with 10 μg/ml Human Plasma Fibronectin (Sigma-Aldrich, FC010). Neurons were mechanically shaken off and removed by patting the flask approximately 2 days after inoculation ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 g/L D-glucose with 1.25% human serum albumin (HSA) (Sigma) and either physiologic (0.1 nM ...
-
bioRxiv - Molecular Biology 2023Quote: The human megakaryoblast leukemic cell line MEG-01 (Sigma-Aldrich, ECACC 94012401) was maintained in RPMI 1640 Medium + GlutaMAX™-I (Gibco™ – Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Fresh citrate-anticoagulated human blood was pre-labeled with Mepacrine (Sigma-Aldrich) for 10 min at RT and perfused over the pre-coated coverslips using a flow chamber system (50 µm x 5 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse antibody specific for human SOD1 (SD-G6 1:100, Millipore Sigma), Mouse anti-human HSP70 specific for stress-inducible HSPA1A (SMC-100B 1:100 ...
-
bioRxiv - Immunology 2023Quote: ... followed by injection of 6.5 U human chorionic gonadotropin (hCG; Sigma-Aldrich) 48 h later ...
-
bioRxiv - Cell Biology 2024Quote: Human retinal pigment epithelial (RPE) cells were cultured in DMEM (Sigma, #D5648) supplemented with 10% fetal bovine serum and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... and (2) the Human Cytokine 23-Plex Discovery Assay® (HD23; Millipore MILLIPLEX® Human Cytokine/Chemokine Magnetic Bead Panel II Immunology Multiplex Assay ...
-
bioRxiv - Microbiology 2024Quote: ... and then incubated with either (1) 20 µg human fibronectin (EMD Millipore); (2 ...
-
bioRxiv - Immunology 2024Quote: ... 5 distinct shRNAs directed against CD2AP encoding human CMS (shCMS) (Sigma-Aldrich Mission TRCN shRNA Target set ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or 96-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C.
-
bioRxiv - Synthetic Biology 2024Quote: ... or 24-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... human full length NHE1 was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) containing a C-terminal 3xFLAG tag ...
-
bioRxiv - Biochemistry 2020Quote: ... a rabbit polyclonal β-actin antibody (A2066) and a rabbit monoclonal Flag antibody (F7425) were from Sigma-Aldrich. A mouse monoclonal Calnexin antibody (MA3-027 ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit α-pH3 (D5692, 1:1000; Sigma), and guinea pig α-HTP-3 (1:200 ...
-
bioRxiv - Developmental Biology 2021Quote: ... PROX1 (rabbit, 1:500 Millipore catalogue # ab5475), β-III TUBULIN (mouse ...
-
bioRxiv - Developmental Biology 2020Quote: ... Prox1 (rabbit, 1:2000, Millipore, Billerica, MA), which recognizes horizontal cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... NeuN (Rabbit, Millipore Sigma ABN78, 1:1000), Spp1 (Mouse ...
-
bioRxiv - Cell Biology 2019Quote: ... NG2 (Millipore AB5320, rabbit polyclonal 1:150), Troponin I (Abcam ab47003 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and histone H2A.Z (rabbit, Millipore, 07-594). All antibodies were diluted 1:1000 for western blotting and 1:250 for immunofluorescence microscopy.
-
bioRxiv - Biochemistry 2020Quote: ... creatine phosphokinase from rabbit muscle (C3755, Sigma), sodium creatine phosphate dibasic tetrahydrate (27920 ...
-
bioRxiv - Neuroscience 2021Quote: ... V5 (rabbit, Millipore, AB3792, WB 1:5000) and those directed against the following proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit HA antibody (Sigma, Cat #6908) were used to detect the GluA2 and CNIHs signal ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit α-p62/SQSTM1-(Sigma; Cat# P0067) Agarose conjugated α-FLAG primary antibody affinity gel beads (Biotool ...
-
bioRxiv - Cell Biology 2021Quote: ... P-VASP/T278 (Rabbit, Sigma Aldrich, SAB4200521), GFP-HRP (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... syntaxin-4 (rabbit, Millipore AB5330, 1:1000), TMED9 (rabbit ...
-
bioRxiv - Plant Biology 2021Quote: ... and secondary α-rabbit-HRP (Sigma Aldrich), or α-CFBPase (cytosolic fructose-1,6-biphosphatase ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit α-NKCC1 (1:1000 Sigma-Aldrich), and mouse α-actin (1:10000 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit α-Tubulin (1:5000; Sigma, USA) and rabbit α-VP39 (1:2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... or GFAP (rabbit, 1:750, AB5804, Millipore) were incubated overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... Non-immune rabbit immunoglobulins were from Sigma. Fluorochrome- and HRP-conjugated secondary antibodies used for detection were from Jackson ImmunoResearch.