Labshake search
Citations for Millipore Sigma :
7801 - 7850 of 10000+ citations for Rabbit Anti Human IgG+IgM+IgA Alexa Fluor 660 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 400ng/mL of human recombinant leptin (Sigma #L4146). In leptin neutralization studies ...
-
bioRxiv - Cancer Biology 2022Quote: ... plasticware was coated using 10 µg/ml human plasma fibronectin (FN) (Millipore).
-
bioRxiv - Cell Biology 2022Quote: Mouse and Human liver sections on ITO glass (Sigma, Milwaukee, WI, US) were stored at -80ºC until analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... gels were rehydrated overnight and coupled to human plasma fibronectin (FC010, Millipore) for 1 h at room temperature using the photoactivatable cross-linker Sulfo-Sanpah (22589 ...
-
bioRxiv - Microbiology 2020Quote: ... using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 mg/ml AAG (human a1-acid glycoprotein, Sigma, Cat # G9885). All medium is sterilized by filtration through a 0.22mm membrane ...
-
bioRxiv - Cell Biology 2019Quote: ... plates and flasks were coated with either: human plasma fibronectin (FN) (Millipore), collagen I (Col I ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by staining with specific antibodies recognizing human YB-1 (#HPA040304, Sigma), ER (SP1 ...
-
bioRxiv - Microbiology 2020Quote: ... using the Non-Human Primate Cytokine MILLIPLEX map 23-plex kit (Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... 5 validated LAMP1 shRNAs were ordered from human Mission lentiviral library (Sigma). HEK293T/17 and A549 cells grown to ∼70% confluency in 6-well plates were transduced with 0.5 ng p24/well of shRNA pseudoviruses ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 ng/mL bFGF (basic recombinant human fibroblast growth factor; Sigma) in flasks coated first with 50 µg/mL poly-L-ornithine (Sigma ...
-
bioRxiv - Systems Biology 2021Quote: ... were coated with 10 µg/ml fibronectin human plasma (Sigma, F2006-1MG) in PBS for 45 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: Human dermal microvascular endothelial cells were maintained on gelatin (G1393; Sigma-Aldrich)-coated tissue-culture Petri dishes in endothelial cell growth Medium MV2 (Promocell ...
-
bioRxiv - Neuroscience 2020Quote: ... human tau constructs were expressed in the vector pNG2 (Merck-Novagen, Darmstadt) in E ...
-
bioRxiv - Immunology 2020Quote: ... using a custom human cytokine 31-plex panel (EMD Millipore Corporation, SPRCUS707). The panel included ...
-
bioRxiv - Cancer Biology 2019Quote: DMS-53 and H1048 human SCLC cells lysed in RIPA buffer (Millipore) containing protease inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Jurkat (ATCC) and U1301 (human T-cell leukemia cell line (01051619, Sigma) were used as short and long telomere controls ...
-
bioRxiv - Cell Biology 2021Quote: ... 40 ng/ml recombinant human long-range IGF-1 (Sigma-Aldrich, USA), 5 ng/ml recombinant IL-6/soluble IL-6R fusion protein ((Fischer et al. ...
-
bioRxiv - Cell Biology 2021Quote: Human erythroleukemia K-562 cells were grown in RPMI-1640 medium (Sigma) supplemented with 10% FBS (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... A MILLIPLEX human cytokine 48-plex panel (Millipore Sigma HCYTA-60K-PX48) was run using supernatant from cells cultured in the presence or absence of poly I:C for 24 hours ...
-
bioRxiv - Biochemistry 2021Quote: Limited proteolysis experiments were conducted with recombinant human cathepsin S (Milipore-Sigma) diluted in phosphate-citrate buffer at pH 5.6 and 37 °C(21) ...
-
bioRxiv - Immunology 2021Quote: ... resuspended in RPMI-1640 complete media containing 10% human AB serum (Sigma) at 2×106/mL and seeded onto 24 well flat bottom plates containing poly-L-Lysine (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... Culture plates were coated with 10 μg/mL human fibronectin (Millipore; FC010), 30 μg/mL BSA (Roche ...
-
bioRxiv - Cell Biology 2019Quote: Recombinant human holo-lactoferrin (iron-saturated) (L1294) was purchased from Sigma-Aldrich. Aliquots were prepared by resuspending in PBS at a concentration of 1 mg/ml and were stored at −20 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The human cerebral endothelial cell line hCMEC/D3 (Millipore-Sigma; SCME-004) used in this study was grown in EndoGRO complete medium with 5% fetal bovine serum and 1 ng/mL FGF-2 (fibroblast growth factor-2).
-
bioRxiv - Microbiology 2021Quote: ... The human cerebral endothelial cell line hCMEC/D3 (Millipore-Sigma; SCME-004) used in this study was grown in EndoGRO complete medium with 5% fetal bovine serum and 1 ng/mL FGF-2 (fibroblast growth factor-2).
-
bioRxiv - Microbiology 2020Quote: ... human lactoferrin (hLF) and bovine lactoferrin (bLF) were purchased from Sigma (USA).
-
bioRxiv - Immunology 2020Quote: ... 50 µM β-mercapthoethanol and 20 µg/ml human apotransferrin (Sigma Aldrich, St ...
-
Highly Versatile, Non-Invasive Method for Collecting Buccal DNA from Free-Ranging Non-Human PrimatesbioRxiv - Genetics 2021Quote: ... a series of human placental DNA (Sigma-Aldrich, St. Louis, MO, USA) at concentrations of 500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... PANC0813 medium was supplemented with 10units/mL human recombinant insulin (Sigma-Aldrich), and MHHNB11 medium was supplemented with MEM Non-Essential Amino Acids (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2022Quote: ... and collagen-IV from human placenta 5 mg/mL (#234154; Sigma-Aldrich) with HEPES (1M ...
-
bioRxiv - Bioengineering 2022Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Bioengineering 2022Quote: Synthesized PEGαMA was reacted with thiolated human dECM and DTT (Sigma-Aldrich) crosslinkers off-stoichiometry (3:8 thiol to αMA ...
-
bioRxiv - Cell Biology 2022Quote: ... mice were injected with human chorionic gonadotropin (hCG) (Sigma Aldrich, Cat# CG5) 48 hours after PMSG injection to stimulate ovulation of Metaphase II-arrested eggs ...
-
bioRxiv - Immunology 2022Quote: ... 50 μM β-mercaptoethanol and 20 μg/ml human apotransferrin (Sigma Aldrich; depleted for human IgG with protein G sepharose) ...
-
bioRxiv - Molecular Biology 2023Quote: Normal Human Dermal Fibroblasts (NHDF) were purchased from Sigma (C-12302, Sigma). Cells were cultured in EMEM (ECB2071L ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 penicillin/streptomycin and 10% male human AB serum (Sigma-Aldrich) (“T-cell medium”) ...
-
bioRxiv - Cancer Biology 2024Quote: ... derived from the cortical region of human fetal brain tissue (Millipore, #SCC007) were cultured as previously described74 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1mM sodium pyruvate and 10 µg/ml human insulin (Cat# 19278, Sigma). HUVECs were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2022Quote: shRNAs plasmids were purified from the MISSION® shRNA Human Library (Sigma). Non-targeting control shRNA (shCo ...
-
bioRxiv - Neuroscience 2024Quote: Human neurons were differentiated from ReNcell VM neuronal precursor cells (EMD Millipore) as described earlier [7] ...
-
bioRxiv - Physiology 2024Quote: ... HBECs were seeded directly onto human placental collagen (HPC, Sigma-Aldrich, C8374)-coated permeable supports (Costar Transwells ...
-
bioRxiv - Cell Biology 2024Quote: Pooled human umbilical vein endothelial cells (Lonza, C2519A or Sigma, 200P-05N) were cultured at 37 °C and 5% CO2 and per manufacture recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Fresh citrate-anticoagulated human blood was pre-labeled with Mepacrine (Sigma-Aldrich) for 10 min at RT and perfused over the pre-coated coverslips using a flow chamber system (50 µm x 5 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Immunology 2022Quote: ... blocking of Fc receptors with human Ig (Sigma-Aldrich, St. Louis, MO); surface staining with mouse anti-human CD3-APC-H7 ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). For analysis of neutrophil activation ...