Labshake search
Citations for Millipore Sigma :
7751 - 7800 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... 3 × 4 ml culture sample were applied in parallel onto three 0.45 μm nitrocellulose filters (Millipore) connected to vacuum ...
-
bioRxiv - Neuroscience 2020Quote: ... were performed with MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in Sanz et al ...
-
bioRxiv - Biochemistry 2020Quote: ... and ligated into the BamHI-XhoI sites of the pETDuet-1 vector (Novagen, Cat#71146-3). The fragment was overexpressed in E ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-FLAG M2 affinity gel (A2220) and 3 x FLAG peptide (F3290) were from Sigma-Aldrich, protein A or G beads were from Invitrogen (10004D) ...
-
bioRxiv - Bioengineering 2020Quote: ... PEDOT:PSS (PH1000, Clevios Heraeus) was mixed to 0.1 v/v% (3-glycidyloxypropyl)trimethoxysilane (440167, Sigma Aldrich), ultra-sonicated for 20 min ...
-
bioRxiv - Neuroscience 2021Quote: ... were permeabilized at 37 °C for 3 hr in 0.2% Triton X-100 (Sigma, T8787, Sigma) in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... were permeabilized at 37 °C for 3 hr in 0.2% Triton X-100 (Sigma, T8787, Sigma) in phosphate-buffered saline (PBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
“A Proteogenomic workflow reveals distinct molecular phenotypes related to breast cancer appearance”bioRxiv - Systems Biology 2020Quote: ... SAX filters-containing tips were put on top of C18 (3 stacked layers; 66883-U, Sigma) stage tips and peptides were eluted with 100 μL of pH 11 BRUB buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE; Corden Pharma, Plankstadt Germany) and Cholesterol (Merck Millipore, Germany) by a thin-film method modified from previously described by Wui (Wui et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Molecular Biology 2021Quote: Monomer solution (1xPBS, 2M NaCl, 8.625% (w/w) Sodium acrylate (97%, 744-81-3, Sigma Aldrich), 2.5% (w/w ...
-
bioRxiv - Cell Biology 2021Quote: ... and were passed through a polycarbonate membrane filter with a 3-µm pore size (Merck Millipore). The supernatants (lysates ...
-
bioRxiv - Immunology 2019Quote: ... Medium D: DMEM supplemented with 3% (v/v) lipoprotein deficient serum medium (LPDS) (Sigma-Aldrich, UK) plus 0.3 mg/ml L-glu ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified protein 5-HT2C or HCA2 (3 μg) was immobilized on nickel agarose beads (Sigma) in the incubation buffer containing 50 mM HEPES ...
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Developmental Biology 2019Quote: ... and washed 3 x 10 minutes in PBT (PBS supplemented with 0.3% tritonX-100 – Sigma T8787). Ovaries were then incubated in a blocking solution (PBTA ...
-
bioRxiv - Cancer Biology 2019Quote: ... were UV-ozone treated and silanized through vapor phase deposition of (3-aminopropyl)triethoxysilane (Sigma-Aldrich) at 90 °C for a minimum of 18 hours ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... lipase from porcine pancreas (Type II) 3 mg/mL (approximately 300 IU/mL, Sigma Aldrich Chemie) were added to the bile salt-containing phosphate buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... and SGE were quantified in relation to ribitol (CAS N°: 488-81-3, A5502 Sigma-Aldrich) as internal standard.
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Genomics 2021Quote: ... All leaf samples were either dried in silica beads (Sigma-Aldrich 1-3 mm particle size) or stored frozen at −20 °C before DNA extraction.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was rinsed 3 × PBS before mounting on histology slides using DAPI containing fluoroshield (Sigma). The whole tissue was then imaged using a Nikon Eclipse TS100 inverted microscope ...
-
bioRxiv - Biochemistry 2020Quote: ... A minimum of 3×106 cells was frozen in 400 μL TRI reagent® (Sigma Aldrich) and stored at -80 °C for RNA analysis at a later date ...
-
bioRxiv - Neuroscience 2020Quote: ... and guanosine-5’-γ-3-thiotriphosphate (GTPγS) were acquired from Sigma-Aldrich (St. Louis, MO, USA). WIN 55,212-2 was purchased from Tocris Bioscience (Bristol ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.5 μL of the quenched reaction mixture was mixed with 3 μL of P1 nuclease (Sigma) (≥0.01 U/μL in 300 mM NaOAc pH 5.0 and 0.15 mM ZnCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... centrifuged at 3500 × g for 30 min followed by a 3 kDa spin filter (2ml, Millipore) twice at 10000 × g for 30 min and finally washed with urea buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... the resulting TCO-containing enzymes were extracted using a 3 kDa cutoff centrifuge filter (Millipore-Sigma) by centrifugation (Eppendorf 5430R ...
-
bioRxiv - Biochemistry 2021Quote: ... the resulting TCO-containing enzymes were extracted using a 3 kDa cutoff centrifuge filter (Millipore-Sigma) by centrifugation (Eppendorf 5430R ...
-
bioRxiv - Biochemistry 2021Quote: ... and the (DE3) lysogen was made using the λDE3 Lysogenization Kit 538 (EMD Millipore #69734-3). Expression was performed as described above apart from chloramphenicol being used with Lemo strains ...
-
bioRxiv - Neuroscience 2021Quote: ... and the cells were permeabilized and blocked with a 3% bovine serum albumin (BSA) (Sigma-Aldrich) 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis assay of U87-MG treated cells was measured using the Caspase-3 assay kit (Sigma). The Caspase-3 colorimetric assay is based on the hydrolysis of acetyl-Asp-Glu-Val-Asp p-nitroanilide (Ac-DEVD-pNA ...
-
bioRxiv - Cell Biology 2019Quote: ... shRNA specific for hERG1b 5’-CCACAACCACCCTGGCTTCAT-3’ and its respective control were purchased from Sigma-Aldrich. For heterologous expression ...
-
bioRxiv - Cell Biology 2020Quote: ... Bead solution on the column was incubated with 3 µL 50U Thrombin (EMD Millipore, Novagen®) in 250 µL wash buffer overnight at 4° C on a rotator ...
-
bioRxiv - Cell Biology 2019Quote: Purified Wss1 wildtype (3.1 μM) or various mutant alleles (3 μM) were incubated with ssDNA (Sigma) (5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC3’ ...
-
bioRxiv - Bioengineering 2020Quote: ... PEDOT:PSS (PH1000, Clevios Heraeus) was mixed to 0.1 v/v% (3-glycidyloxypropyl)trimethoxysilane (440167, Sigma Aldrich), filtered (1 μm PTFE filters) ...
-
bioRxiv - Immunology 2020Quote: ... larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich). Simple tail transection of the caudal fin was performed using surgical blade (Feather ...
-
bioRxiv - Microbiology 2021Quote: ... A carboxylated indene standard (1H-Indene-3-carboxylic acid) was purchased from Sigma-Aldrich (catalog #MNO000013). Hexanes and acetone (Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... Tumours were then transferred to digestion medium composed of 3 mg/ml collagenase A (Sigma, 10103586001) and 25 μg/ml DNAse I (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The Netherlands) at 37 °C with 100 μM Sodium 3-(3,4-dihydroxyphenyl)-DL-lactate (39363,Sigma). Samples were taken at 0 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2019Quote: Full-length IN and CCD sequences derived from pNL4-3 were introduced to pET30a vectors (Novagen) with Hisx6 tagged at the C-terminus or N-terminus ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6J mice were intraperitoneally injected with 1 ml of 3% Brewer thioglycollate medium (Sigma-Aldrich). Elicited peritoneal neutrophils and macrophages were collected 1 day and 3 days after the injection ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 KDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C at 12,000 g ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 minutes at 4°C at 12,000 g ...
-
Disparate regulation of imd drives sex differences in infection pathology in Drosophila melanogasterbioRxiv - Immunology 2020Quote: ... 3 flies were homogenised in 100μl of the single-step RNA isolation reagent TRI Reagent (Sigma), followed by a chloroform extraction and precipitation in isopropanol ...
-
bioRxiv - Immunology 2021Quote: ... dibutyryl cyclic adenosine monophosphate (db-cAMP) and 3-isobutyl-1-methyxanthine (IBMX) were purchased from Sigma. Complete RMPI consisted of RPMI 1640 (Gibco ...