Labshake search
Citations for Millipore Sigma :
7201 - 7250 of 10000+ citations for Rat Epithelial membrane protein 1 EPN3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Membrane was pre-hybridized for 20 min with PerfectHyb(tm) Plus Hybridization Buffer (Sigma-Aldrich). DNA oligos directed against hsa-miR-124-3p (5’ GGCATTCACCGCGTGCCTTA 3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... embryos were transferred to an air-permeable membrane and mounted in Halocarbon 27 oil (Sigma). A coverslip was placed on embryos for live-imaging ...
-
bioRxiv - Molecular Biology 2020Quote: ... The slices were maintained on a culture insert membrane (Millicell-CM; Millipore, Bedford, MA, USA) and dipped into culture medium (50 % minimum essential medium ...
-
bioRxiv - Biochemistry 2019Quote: ... Solutions were filtered through a PVDF membrane with a pore size of 0.45 μm (Millipore) and concentrations were determined spectrophotometrically using an extinction coefficient ε280 = 58.4 × 103 M−1 cm−1 in 0.1 M NaOH (Dawson et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... The immunoblotting was done using 12% acrylamide gels and PVDF membrane transfer (Millipore #IPFL00010, 0.45µm). Membranes were blocked in Odyssey PBS Blocking Buffer (LiCor) ...
-
bioRxiv - Bioengineering 2020Quote: ... the glass fiber capture membrane was washed three times in nuclease free water (Sigma-Aldrich) and dried overnight at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... Extracted HMW DNA was purified via drop dialysis using Millipore membrane filters (EMD Millipore, USA) placed on Tris-EDTA buffer for 3 hours.
-
bioRxiv - Microbiology 2020Quote: ... The membrane was probed with mouse monoclonal ANTI-FLAG® M2-Peroxidase (HRP) antibody (Sigma), 1:10 000 ...
-
bioRxiv - Immunology 2019Quote: ... Cell lysates were separated by SDS-gel electrophoresis and transferred to PVDF membranes (Merck Millipore). Immunoblotting was performed using the following antibodies from Cell signaling ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane was stripped and re-probed with mouse tubulin-alpha ab-2 (Sigma-Aldrich), 1:5000 dilution.
-
bioRxiv - Pathology 2021Quote: ... The membrane was washed three times with 0.5% Tween 20 (Sigma-Aldrich, St. Louis, MO) in PBS solution for 5 min each cycle ...
-
bioRxiv - Immunology 2020Quote: ... Transfer and loading were validated by staining membranes in 0.2% Ponceau S solution (Sigma-Aldrich) for 2 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... the membranes had been coated with 0.125 mg/mL type II collagen (C9301, Sigma-Aldrich) in 0.1 M acetic acid ...
-
bioRxiv - Bioengineering 2019Quote: ... The filtered culture broth was concentrated using an Amicon Ultra-15 membrane filter (Millipore, Germany) as extracellular crude protein samples for isolation ...
-
bioRxiv - Genetics 2020Quote: ... for 50 minutes at 150 V and transferred to polyvinylidene difluoride (PVDF) membrane (Merck Millipore) at 30 V for 1 hour ...
-
bioRxiv - Cell Biology 2019Quote: ... The eluate was concentrated using a 30 kDa cut-off membrane (Sigma-Aldrich, #Z677892-24EA) and the final volume adjusted to 900 µl with ice-cold G-buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... All membrane incubations and washes were performed in PBS with 0.05% Tween-20 (Sigma, P1379). Membrane band quantification was performed with ImageJ ...
-
bioRxiv - Microbiology 2021Quote: ... cells were then collected by filtration using 0.45-µm mixed cellulose ester membrane filters (Millipore) and resuspended in PBS stained with 10 µg/ml propidium iodide (PI ...
-
bioRxiv - Immunology 2021Quote: ... Membranes were developed by chemiluminescence using the Immobilon Western Chemiluminescent HRP Substrate (Millipore, Cat# WBKLS0500) and recorded using ChemiDoc MP Imaging System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2021Quote: ... run on SDS-PAGE gel and transferred to polyvinylidene fluoride membrane (PVDF) (Millipore, Bedford, MA). Membranes were immunoblotted for DAT (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysates were subjected to SDS-PAGE and transferred to PVDF membranes (Millipore, Darmstadt, Germany). Finally ...
-
bioRxiv - Microbiology 2022Quote: ... The collected fluid was then passed through 0.20-μm Micropore Express Plus membrane filters (Millipore) to collect the bacteria ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slices were placed with flat spatulas on top of 0.8 μm pore membranes (Sigma Aldrich) floating on slice culture media (DMEM ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were incubated with TIA1 and Actin B antibodies (Abcam #ab40693 and Sigma #A5441, respectively) in 5% milk in PBS+Tween 20 (0.05%) ...
-
bioRxiv - Neuroscience 2021Quote: ... The membrane was blocked with Tris-buffered saline containing 0.1% Tween-20 (TBST, Sigma-Aldrich) supplemented with 5% skimmed milk for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Each sample was separated using SDS–PAGE and transferred to a polyvinylidene fluoride membrane (Millipore). Immunodetection was performed using an appropriate primary antibody ...
-
bioRxiv - Developmental Biology 2021Quote: ... donor cells were recommended for optimal staining with the fluorescent membrane dye PKH26 (Sigma-Aldrich) for 5 minutes according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... A membrane filter (Sigma-Aldrich Company Ltd., Dorset, UK; MF-Millipore, 0.22 µm pore size) was placed between the syringe and the dispensing tip (Intertronics ...
-
bioRxiv - Cell Biology 2020Quote: ... according to the manufacturer’s instructions (Avanti Polar Lipids, USA; membranes were purchased from Sigma, Switzerland). Osmolarities of CDV hosting solutions were determined with an osmometer (Osmomat 3000basic ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were blocked in either 5% w/v milk or 2.5% BSA (Sigma, A3608) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were resolved by SDS-polyacrylamide gel electrophoresis and transferred onto PVDF membranes (IPVH00010, Millipore). Membranes were blocked in 5% milk before adding antibodies of interest ...
-
bioRxiv - Cancer Biology 2021Quote: ... 12-16% or 16% SDS-PAGE gels and transferred to Immobilon-P PVDF membranes (Millipore) with 0.45 um (CA9 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were exposed to the Immobilon™ Western Chemiluminescent HRP Substrate (Millipore, Billerica, MA, USA). Blots were detected on X-ray film using the ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and subjected to SDS-PAGE followed by transferring to PVDF membranes (Millipore, Billerica, MA, USA). Membranes were incubated with antibodies specific for ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were washed in Tris-buffered saline with 0.1% (vol/vol) Tween 20 (TBST, Sigma) before blocking in 5% (wt/vol ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to PVDF membranes at 70V for 2 hours or overnight (Immobilon P, Millipore). Ponceau S staining was used to verify even transfer (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were separated by SDS-PAGE and transferred to a PDF membrane (Millipore, Billerica, MA). The membrane was blocked with PBS containing 0.5% tween (PBST ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were then rinsed in deionized water and prehybridized with PerfectHybTM Plus Hybridization Buffer (Sigma) at 42°C for 20-60 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... 7,4’-dihydroxyflavone and the plasma membrane microsomes using nitrocellulose filters (0.45 mm pore-size; Millipore). The transport assays were performed with microsomes corresponding to 520 ng·μl-1 protein concentration mixed with transport buffer (10 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were then probed with primary antibodies specific for murine caspase-11 (#C1354; Sigma-Aldrich), caspase-3 (#9662 ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were washed three times with TBS-T (Tris-buffered-saline/0.1% Tween 20 (Sigma)) and incubated overnight at 4°C with primary antibodies in 2% BSA/TBS-T (0.1%) ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% or 15% SDS polyacrylamide gels and transferred to a PVDF (polyvinylidene fluoride) membrane (Millipore) at 100 V for 2 h ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then transferred to Immobilon-P-polyvinylidene difluoride (PVDF) 0.45 μm membranes (Millipore, USA) for 55 minutes at 80 mA per blot using a semi-dry transfer cell ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were washed in Tris-buffered saline with 0.1% (vol/vol) Tween 20 (TBST, Sigma) before blocking in 5% (wt/vol ...
-
Morphine-induced side effects can be differentially modulated by cannabidiol in male and female ratsbioRxiv - Pharmacology and Toxicology 2024Quote: ... followed by a filtration with a 0.45 µm Durapore membrane filter (Millipore, São Paulo, Brazil). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times in TBS buffer supplemented with 0.1% TWEEN-20 (Millipore P1379), probed with 1:5,000 dilutions of donkey anti-rabbit IRDye680 (Licor 926-68023 ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was filtered twice through 0.45 μm PVDF membrane filters (Millipore, Billerica, MA, USA) to remove bacteria (confirmed by colony counts ...
-
bioRxiv - Neuroscience 2024Quote: ... before being transferred onto Immobilon-P polyvinylidene fluoride membranes (#IPVH00010, 0.45 mm pore size; Millipore) in NuPAGE™ Transfer Buffer with methanol 20% (NP0006 ...
-
bioRxiv - Neuroscience 2024Quote: ... The isolated retina was mounted on a small piece of filter paper (MF-membrane, Millipore), in which a 2 × 2 mm window had been cut ...
-
bioRxiv - Cancer Biology 2024Quote: ... The membrane was washed again before developing with Luminata Classico Western HRP substrate (Millipore, #WBLUR0100) Luminata Classico Western HRP substrate (Millipore ...