Labshake search
Citations for Millipore Sigma :
651 - 700 of 2403 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and stained for 5 minutes at RT with Giemsa (Sigma) diluted 1:1 in deionized water ...
-
bioRxiv - Pathology 2022Quote: ... permeabilized (0.1% Triton X-100, Sigma, in PBS, 20min., RT), blocked with 2% goat serum (Life technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted using RNAzol®RT (Sigma-Aldrich) and 2 µg of total RNA was subjected to reverse transcription using qScript cDNA Synthesis Kit (Quanta) ...
-
bioRxiv - Cell Biology 2020Quote: ... the TRAPEZE® RT Telomerase Detection Kit (Chemicon; EMD Millipore) was utilized ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Kicqstart One-Step Probe RT-qPCR ReadyMix (KCQS07; Sigma). Gli1 (Wen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... RT and alkylated using 5.5 mM of iodoacetamide (Sigma-Aldrich) for 45 min ...
-
bioRxiv - Immunology 2022Quote: ... fixed cells were blocked at RT with 1% BSA (Sigma) in PBS for 30 min and permeabilized with 0.1% Triton-X100 (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... were incubated for 1h at RT and DAPI (Sigma-Aldrich) was added for 10min to counterstain nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... for 20 min at RT and 70% isopropanol (Sigma-Aldrich) was added for 5 min ...
-
bioRxiv - Genetics 2023Quote: ... and 1 volume of chloroform (2 min, RT, Sigma Aldrich), the aqueous phase was recovered after centrifugation at 12 000 g ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was isolated using RNAzol®RT (Sigma- Aldrich) as per manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... After on-column DNase treatment with the DNase I Digest Set (Sigma-Aldrich, Taufkirchen, Germany) the RNA was quantified ...
-
bioRxiv - Plant Biology 2020Quote: ... After on-column DNase treatment with the DNase I Digest Set (Sigma-Aldrich, Taufkirchen, Germany), the RNA was quantified ...
-
bioRxiv - Cell Biology 2021Quote: ... the exposed surface was immediately re-embedded in Durcupan ACM resin (Sigma Aldrich, set 44610). The detail procedures of coverslip preparation ...
-
TRPA1 block protects against loss of white matter function during ischaemia in the mouse optic nervebioRxiv - Neuroscience 2021Quote: ... and 0.05 Alexa Fluor 594 pH set to 7.15 with K-OH (all from Sigma). For Ca2+ imaging experiments ...
-
bioRxiv - Microbiology 2019Quote: ... These experiments were set up in duplicate so that biofilm determination with crystal violet (Sigma) and viable cell counts could be performed in parallel ...
-
bioRxiv - Neuroscience 2019Quote: ... Cortices were homogenized using a Dounce tissue grinder set (Loose followed by Tight pestle, Sigma) in ice cold 300 μl RIPA buffer supplemented with Complete EDTA-free Protease inhibitor (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NP-40 supplemented with protease inhibitor cocktail set V EDTA free (Millipore, Billerica, MA) and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... and one set was treated with 1.5 uM 6-TG (Sigma Aldrich, Cat. No. A4882) for 4 days to screen for cells with MLH1 successfully knocked out ...
-
bioRxiv - Microbiology 2023Quote: ... and one set of two replicates were treated with 0.2 μg/ml tetracycline (T3383, Sigma) for 90 min ...
-
bioRxiv - Genetics 2024Quote: ... quantification in the heads of both starved and non-starved miR-210 KO and WT flies was carried out using the Triglyceride Quantification Kit (Sigma-Aldrich, St. Louis, Missouri, USA), following the provided manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... and primers (See Supplementary Table 3) were synthesized by Sigma-Aldrich. The expression of each gene was normalized to the geometric mean expression of two reference genes Hprt and Ubc ...
-
bioRxiv - Cell Biology 2022Quote: ... The primers used in this study were manufactured by Sigma-Aldrich and sequencing reactions were carried out by AgriGenome Labs Pvt ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR was performed using PAGE purified primer pairs (Sigma; Table S1) that spanned appropriate promoter regions of interest ...
-
bioRxiv - Microbiology 2019Quote: ... 20 ng of cDNA and 0.2 µM of each primer (Sigma). For amplification of cDNA of fHbp ...
-
bioRxiv - Physiology 2021Quote: ... according to the manufacturer’s protocol and using specific primers (Sigma-Aldrich) for genes of interest (Table S1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cloning and sequencing primers were supplied by Sigma (Burlington, MA). All plasmids were grown up in Top10 competent bacteria (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: Primers were purchased as 20μM stocks (Sigma-Aldrich, standard de-salt). AxFUCCI plasmid sequence was verified by Sanger sequencing.
-
bioRxiv - Microbiology 2021Quote: ... using PAGE-purified oligonucleotide primers (Sigma-Aldrich, St. Louis, MO, USA) according to manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primers used for H3K27me3 ChIP-qPCR were synthetized by SIGMA-ALDRICH. Primer sequences were:
-
bioRxiv - Microbiology 2022Quote: ... The forward primer contained a 6-FAM (6-carboxyfluorescein) tag (Sigma). EMSA reaction mixtures (25 μL volume ...
-
bioRxiv - Biochemistry 2022Quote: ... two corresponding primers (synthesized by IDT) and KOD polymerase (Sigma-Aldrich). Specifically ...
-
bioRxiv - Physiology 2022Quote: ... The primers were customized and purchased from Sigma-Aldrich (now Merck): human Rpl0 fw (TCGACAATGGCAGCATCTAC) ...
-
bioRxiv - Neuroscience 2022Quote: ... The sequence for telomere-specific forward and reverse primers (Sigma-Aldrich) are 5’ CGG TTT GTT TGG GTT TGG GTT TGG GTT TGG GTT TGG GTT 3’ & 5’ GGC TTG CCT TAC CCT TAC CCT TAC CCT TAC CCT TAC CCT 3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... using FAM-labelled forward primers (Sigma Aldrich; St. Louis, MO, USA). Microsatellite profiles were analysed with Geneious 8.0.5 and checked with MICROCHECKER v2.2.3 (http://www.microchecker.hull.ac.uk/ ...
-
bioRxiv - Microbiology 2023Quote: ... and desalted primers (Sigma-Aldrich, St. Louis, MO, Table S 3), with an initial 10-minute incubation at 95 °C to release E ...
-
bioRxiv - Genomics 2023Quote: ... 0.5 μl of 2nd primer UMI8 (Table S2, 100μM, Sigma-Aldrich), containing 8 mer UMI sequence and 1.3 μl of DMSO ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primer sequences used to amplify genes were purchased from Sigma-Aldrich and are listed in Supplementary Table S3.
-
bioRxiv - Cell Biology 2020Quote: ... for 30 min at RT followed by 1 h incubation at RT with rabbit anti-FLAG antibody (1:500, Sigma-Aldrich, St. Louis, MO, USA) and mouse anti-SEC31A antibody (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... USA) with the antibody extraction buffer prepared by adding the protease inhibitor cocktail set I (Millipore) to 2x PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was treated with DNAse in solution using On-Column DNase I Digestion Set (Sigma-Aldrich) and maintained with Ribosafe RNAse Inhibitor (Bioline) ...
-
bioRxiv - Cell Biology 2019Quote: ... Blots were labelled with the appropriate set of antibodies: primary rat anti-HA (1:500, Sigma), mouse anti-Myc (1:1000 ...
-
bioRxiv - Plant Biology 2020Quote: ... Genomic DNA contamination was eliminated by using the On-Column DNase I Digestion Set (Sigma-Aldrich, St ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from three sets of 10 Drosophila heads using TRI-Reagent (T9424, Sigma) and RNA was reverse transcribed using an iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... On-column DNase digestion was performed as described with On-Column DNaseI Digestion Set (Sigma Aldrich). For the 7 DAP reference ...
-
bioRxiv - Developmental Biology 2022Quote: ... A DNase removal step was included using an on-Column DNase 1 Digestion Set (Sigma-Aldrich). The total RNA was quantified using a Nanodrop-ND1000 Spectrophotometer (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... a subset of slices were mounted in a hard-set mounting medium (2.5% DABCO (D27802; Sigma), 10% polyvinyl alcohol (P8136 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA and 1% Nonidet P-40) supplemented with protease inhibitor (Cocktail Set III; Millipore) for 10 mins on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM BME) and 4 μl of protease inhibitor (Protease Inhibitor Cocktail Set IV, EMD Millipore) was added to every gram of cell powder ...
-
bioRxiv - Neuroscience 2022Quote: ... reactions were set up in assay buffer containing 20 mM sodium phosphate (pH 6.9; Sigma-Aldrich), 300 mM NaCl (Sigma-Aldrich) ...