Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ten µL of ligand (10-5 M isoproterenol or Thrombin (Sigma Cat# T4648) at 100 U/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 nanomoles of JF552-Halotag ligand were dissolved in 20μl of DMSO (Sigma), diluted first in 20 μl of Pluronic™ F-127 (20% w/v in DMSO ...
-
bioRxiv - Molecular Biology 2021Quote: ... and input TRF1 mutants were revealed with anti-His (anti 6-His Rabbit Pab Sigma Aldrich). For the detection of biotin-labelled PARylated proteins the same assay was conducted in presence of biotin-NAD+ (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: Lyophilized human haptoglobin phenotype 1-1 (Hp) and human α,β haemoglobin (Hb) were purchased from Sigma Aldrich. Deglycosylation enzyme PNgase F was from New England BioLabs Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The chopped and digested pieces were placed in a serrated 60mm petri dishes and supplemented with 10ng/μl each of human recombinant epidermal growth factor (hEGF, Cat # E9644, Sigma-Aldrich), N2 suppliment-1X (Cat # 17502048 ...
-
bioRxiv - Microbiology 2019Quote: ... we performed growth curves in YPD liquid medium containing different concentrations of Gal-3 (Gal-3 human recombinant, expressed in E. coli, Sigma-Aldrich) in a 96-well plate (Costar ...
-
bioRxiv - Molecular Biology 2022Quote: ... the native or reconstituted chromatin samples (140 μg DNA/ml) in HNE were treated with 25 μg/ml human recombinant PAD4 enzyme (Sigma Aldrich cat # SRP0329 or Cayman Chemical cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant Human Protein #PHG0264), 10 ng/ml epithelial growth factor (EGF, Recombinant Human Protein #PHG0311) and 10 µM ROCK Inhibitor Y-27632 (Sigma, #Y0503) were added to the media freshly before use ...
-
bioRxiv - Cell Biology 2023Quote: In vitro kinase assays were performed in the presence or absence of different recombinant human atypical PKC (50 or 100 ng of PKC ζ, #14-525 Merk Millipore; 1µg of PKC I/αPar6 complex ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 µM carnitine) with or without supplementation of 100 ng/ml (13.16 nmol/l) IGF1 (human recombinant IGF1, I3769, Sigma-Aldrich, Germany). Medium was changed three times per week and 48 hours before harvest ...
-
bioRxiv - Biochemistry 2024Quote: Human embryonic kidney cells (HEK293T) and human fibroblast cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Sigma Aldrich), supplemented with fetal bovine serum (FBS ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were also treated with 1 μM 5-Aza-2’-deoxycytidine (Sigma) or 100 nM chaetocin (Cayman Chemical) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 1-2 mg/ml G418 (Sigma-Aldrich, G8168) (untagged rescue plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... Fc-tagged and non-Fc-tagged proteins were concentrated using Amicon Ultra 10 kDa MWCO centrifugal filter units (Millipore), dialyzed against PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2-methyl-2-propanethiol (Sigma 109207), 0.01% acetophenone (Sigma W200910) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2- methyl-2-thiazoline (Sigma M83406), 1% citronellol (Sigma W230915) ...
-
bioRxiv - Systems Biology 2022Quote: ... were coated with 2 μg/mL fibronectin human plasma (FN) (Sigma Aldrich) and incubated for 30 min at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... or anti-His antibodies (Sigma- Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... anti- HIS from Novagen (70796-3), anti-TGN38 from BD Transduction (610898) ...
-
bioRxiv - Biochemistry 2019Quote: His-select Cobalt affinity beads (Sigma) were equilibrated in binding buffer (40 mM HEPES pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-His (Sigma-Aldrich, H1029, RRID:AB_260015), anti-Strep (IBA GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... or anti-His antibody (EMD Millipore) as described previously [39] ...
-
bioRxiv - Biochemistry 2023Quote: ... or anti-His antibody (EMD Millipore) as described previously [39] ...
-
bioRxiv - Neuroscience 2023Quote: ... His•Tag® (Millipore, 70796-3), anti-APP C-Terminal Fragment (BioLegend ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant hyaluronidase (Sigma, H3506) was treated at 10 μg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant neuraminidase (Sigma, N2876) was treated at 1 U/mL ...
-
bioRxiv - Immunology 2022Quote: ... recombinant CD4 (Sigma Aldrich) were added to 20 μl of KSRB with 1mM APMA ...
-
Dimeric prion protein ligand activates Adgrg6 but does not rescue myelinopathy of PrP-deficient micebioRxiv - Neuroscience 2020Quote: ... anti-human Fab (1:7000, Sigma, A0293).
-
bioRxiv - Cell Biology 2019Quote: ... containing 1% heat inactivated human serum (Sigma) and 1% Pen-Strep ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 1% heat-inactivated human serum (Sigma) and 1% penicillin-streptomycin ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 1% heat inactivated human serum (Sigma) and 1% penicillin-streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 nM human Gastrin 1 (Sigma Aldrich) 10 mM Nicotinamide (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 μg/mL human fibronectin (Millipore). Cells were seeded at a density of 35,000-50,000 cells/cm2 and differentiated for 5 days in DMEM:F12 medium supplemented with 1% N-2 ...
-
bioRxiv - Microbiology 2022Quote: ... α-human TMPRSS2 (1:1,000; HPA035787 Sigma-Aldrich) or α-β-actin (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-human TMEM119 (1:100, Sigma, #HPA051870), anti-mouse CD68(1:200 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg of human PLG (Sigma-Aldrich) was added to each well and incubated for 2 h at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... TEBP-1-His5 and TEBP-2-His5 were expressed in Rosetta 2 (DE3) pLysS Competent Cells (Novagen,#71401). An overnight culture was grown in LB containing the respective antibiotic ...
-
bioRxiv - Bioengineering 2023Quote: Photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy) phenyl]-2-methyl-1-propanone (HEPK, Sigma Aldrich) was dissolved into deionized water to obtain an approximately 0.077 wt% solution ...
-
bioRxiv - Microbiology 2020Quote: rAkata EBV-infected cells was reactivated at 1×106 cells/mL with a goat polyclonal anti-human IgG Fc-specific antibody (Sigma) for 48 hours ...
-
bioRxiv - Microbiology 2021Quote: ... 293T-ACE2 cells stably expressing human ACE2 are derived from 293T cells and were maintained in medium supplemented with 2 µg/mL of puromycin (Millipore Sigma) (Prévost et al. ...
-
bioRxiv - Cell Biology 2021Quote: HUVEC were seeded at 5×104 cells or 2×105 cells in 24-well plates on coverslips coated with 10 μg/ml fibronectin (from human plasma, Sigma Aldrich) and incubated overnight in complete EBM-2 medium ...
-
bioRxiv - Cancer Biology 2020Quote: ... All other cell lines were grown in Dulbecco`s modified Eagle medium (DMEM) (Fisher, UK) supplemented with 2% human serum (Sigma, UK) and maintained in an humidified sterile incubator with 5% CO2 at 37°C.
-
bioRxiv - Molecular Biology 2020Quote: Primer sequences for markers were obtained from the UCSC genome browser and standard HEX-tagged primers (Sigma-Aldrich, Supplementary Table 2) were used to assess the flanking haplotypes of MMP20 ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysate was then incubated with HIS-select HF Nickel Affinity Gel (Millipore-Sigma) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The cell lysate was then incubated with HIS-select HF Nickel Affinity Gel (Millipore-Sigma) overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... periplasmic expression of the recombinant GFP-nanobody in BL21(DE3) Rosetta cells (Novagen) was induced with 0.1 mM IPTG for 16 hours at 16°C ...