Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Cell lysate was added overnight to an ELISA plate precoated with anti-Itgb1 antibody (Sigma#MAB1997), the plates were then washed and the Itgb1 levels measured upon addition of HRP-streptavidin using a microplate reader at 405 nm with ABTS substrate ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA encoding MHC heavy chain (HLA-C*08:02 and H-2 Kb) and light chain (human β2M and mouse β2M) was synthesized (Idobio) and cloned into pET-22(b) vector (Novagen). The vectors were transformed into the E ...
-
bioRxiv - Neuroscience 2021Quote: ... standard Western blot was performed using anti-SST and anti-α-Tubulin (1:8,000, B-5-1-2, mouse monoclonal, Sigma).
-
bioRxiv - Cell Biology 2024Quote: The following antibodies were used for immunohistochemistry and western blots: mouse anti-tubulin clone B-5-1-2(Millipore Sigma), rabbit anti-CAPS (Abcam EPR15631) ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated as described above with a 0.5 μg/ml mouse α-tubulin antibody (clone B-5 1-2, Sigma) as a loading control.
-
bioRxiv - Microbiology 2024Quote: ... α-tubulin was detected as a loading control with the mouse monoclonal antibody B-5-1-2 (Sigma, T5168, 1/4000) for 2 hrs at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... and tagged proteins were detected with mouse anti-GFP (Sigma, 1:5,000), rat anti-HA (Sigma 3F10 clone ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Proteins were probed with mouse anti-FLAG (1:5,000 Sigma-Aldrich, F3165) or anti-β-actin (1:5,000 Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein G Dynabeads were pre-equilibrated with mouse anti-FLAG antibody (Sigma) and added to clarified extract for 3 h at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 1000 units/ml ESGRO Recombinant Mouse LIF protein (Millipore #ESG1107), 10% fetal bovine serum ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse Anti-Glial Fibrillary Acidic Protein (1:100, Millipore, Cat# MAB360, RRID:AB_11212597), Mouse Anti-NeuN (1:1000 ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse monoclonal anti-glial fibrillary acidic protein (1:1000, Millipore Sigma, #MAB3402), rat monoclonal anti-CD45 (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-glial fibrillary acidic protein (GFAP, 1:1000, Millipore Sigma, USA), anti-NeuN (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used were acetylated α−tubulin (1:500, clone 6-11-B1, Sigma-Aldrich, St. Louis, MO), rabbit polyclonal DNALI1 (1:100 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: The protein content was analysed with the Bicinchonic Acid Protein Assay Kit (Sigma-Aldrich) according to the manufacturer’s protocol with minor adjustments ...
-
bioRxiv - Physiology 2022Quote: ... Protein carbonylation was assessed with an Oxyblot protein oxidation detection kit (#S7150, Merck Millipore) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein precipitation was carried out using ProteoExtract Protein Precipitation Kit (EMD Millipore, 539180-1KIT) according to the manufacturer’s protocol and submitted for MS analysis to the Taplin Biological Mass Spectrometry Facility.
-
bioRxiv - Molecular Biology 2024Quote: Total carbonylated proteins were quantified using OxyBlot Protein Oxidation Detection Kit (Millipore, Billerica, MA) following manufacturer’s instructions using 15 μg of total protein detected with rabbit anti-DNP antibodies (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: The Protein-G CoIP kit (IP50, Sigma Aldrich) was used for coimmunoprecipitation (CoIP ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein bands were visualized using ECL kit (Millipore).
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2019Quote: ... and B-actin (A5441, Sigma) were used at dilution 1:1000 and 1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 µg/mL) ...
-
bioRxiv - Cell Biology 2019Quote: ... Latrunculin B (Sigma, 5 µM) was added to the culture media for 10 min before 20 min of rapamycin ...
-
bioRxiv - Microbiology 2021Quote: ... and polymyxin B (Sigma-Aldrich), were serially diluted 1 in 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... antifoam B (Sigma, 1:5000), and 40U/mL RNAsin (Promega)) ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5μg/mL Polymyxin B (Sigma) was used as permeabilizing agent in the positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma). Spinner-adapted L929 cells (originally obtained from the Bernard Fields laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:5000 Antifoam B (Sigma) and lysed by vortexing with acid-washed glass beads for 2 min followed by 2 min on ice for three cycles ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM b-mercaptoethanol (Sigma) and 1000 U/mL of LIF (Chemicon) ...
-
bioRxiv - Neuroscience 2021Quote: ... rhodamine B (RhoB; Sigma Aldrich), Rp-8-Br-PET-cGMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by pestle B (Sigma), and filtered through a 70-um cell strainer (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... b-actin (Sigma, AC-15), P-eIF2a (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... 200 nM b-mercaptoethanol (Sigma), 1 % sodium pyruvate (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... B-Actin (A1978; Sigma-Aldrich).
-
bioRxiv - Immunology 2020Quote: ... Amphotericin B (all Sigma-Aldrich), and BD Difco™ BBL™ Middlebrook ADC Enrichment and incubated at 37 °C with agitation with a magnetic stir bar ...
-
bioRxiv - Microbiology 2019Quote: As hygromycin B (Sigma-Aldrich) was used as the selection marker during transformations ...
-
bioRxiv - Microbiology 2020Quote: ... Polymyxin B nonapeptide (PMBN; Sigma), a non-toxic polymyxin derivative ...
-
bioRxiv - Cell Biology 2021Quote: ... Rhodamine B solution (Sigma, 02558) was diluted to 10% in water and image stacks were acquired in the red channel during laser application ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amphotericin B (Sigma, Cat#:A2942) at 250µg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... and B-ACTIN (Sigma A5441).
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma) or infection medium (growth medium containing 2% FBS) ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1% amphotericin B (Sigma). SV-40 immortalized endothelial cells (SVECs ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rhodamine B (Sigma, Cat R8881) was co-injected with MOs as a dye ...
-
bioRxiv - Bioengineering 2022Quote: ... amphotericin-B (0.2 mL, Sigma), and cell medium (6.75 mL) ...
-
bioRxiv - Immunology 2022Quote: ... Staphylococcus enterotoxin B (SEB; Sigma) stimulation (200ng/ml ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and amphotericin B (Sigma-Aldrich) was performed by determining the minimal inhibitory concentration (MIC ...