Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for Mouse FAM117A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... TSC1 or AMPK knockdown in RPE1 cells were achieved by infecting cells with viruses derived from pLKO-1 harboring the shRNAs against TSC1 (TRCN0000010453 and TRCN0000039734, Sigma) or AMPK (TRCN00000196482 and TRCN00000219690 ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were purified using a GenElute HP Plasmid MidiPrep Kit (Sigma-Aldrich). To generate plasmids for CRISPR/Cas9 KO cell lines ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid DNA was isolated using GenElute ™ Plasmid Miniprep Kit (Sigma-Aldrich) and sequenced using the M13 primers ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmid was then extracted by GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich) and verified by DNA sequencing (BMR Genomics ...
-
bioRxiv - Biophysics 2020Quote: ... Plasmids were purified using a GenElute HP Plasmid MidiPrep Kit (Sigma-Aldrich). The tgLAT construct(20 ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids were purified with the GenElute Plasmid DNA Miniprep Kit (Sigma-Aldrich), quantified using the Qubit fluorometer (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmid was isolated using “GenElute™ Plasmid Midiprep” kit (Sigma Aldrich) and digested with SmaI (Thermo Scientific)
-
bioRxiv - Neuroscience 2022Quote: Plasmid DNA was purified with the GenElute HP Plasmid miniprep kit (Sigma) and microinjected in the worm gonad according to a standard protocol (Evans ...
-
bioRxiv - Molecular Biology 2022Quote: ... plasmids were purified using the GenElute HP Plasmid Midiprep Kit (Sigma-Aldrich). All of the L1 expression plasmids contain a retrotransposition-competent L1 (L1.3 ...
-
bioRxiv - Microbiology 2023Quote: ... Afterward the plasmid was isolated using GenElute plasmid miniprep kit (Sigma Aldrich). The recipient strains (AMp07 and WSM419 ...
-
bioRxiv - Plant Biology 2019Quote: Plasmid pFLAG-ATS (Sigma) was used for protein expression in this study ...
-
bioRxiv - Molecular Biology 2019Quote: pLKO.1 plasmids (Sigma) encoding shRNA for Sertad4 (TRCN0000247967 and TRCN0000247969 ...
-
bioRxiv - Microbiology 2020Quote: ... pET-32a plasmid (Novagen) was used ...
-
bioRxiv - Microbiology 2023Quote: ... the pET28a plasmid (Novagen) was used ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pSTBlue-1 (Novagen) was used as the vector for routine DNA manipulations ...
-
bioRxiv - Cancer Biology 2021Quote: ... SMO-inhibitor resistant Daoy cells with shRNA-mediated knockdown of SUFU had been generated in our lab using the TRCN0000019466 construct (Sigma-Aldrich) [52].
-
bioRxiv - Cell Biology 2020Quote: ... or human NUP153-specific shRNA lentivirus particles overnight at 37°C followed by selection in medium containing Puromycin (Puro, 2 μg/ml) (Sigma-Aldrich) for 48 hr ...
-
bioRxiv - Cell Biology 2020Quote: Lentiviral particles were either generated by the laboratory (NF-κB or p53 reporter) or obtained from the MISSION shRNA library (Sigma-Aldrich). These obtained lentiviral particles harbor the following shRNA clones in pLKO.1 backbone vector and were used to infect BJ cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... and RSV-Rev) and a SERPINE1 shRNA construct encoded in a PLKO.1 vector (henceforth called shPAI1: TRCN0000370159, sense: ACACCCTCAGCATGTTCATTG; Sigma-Aldrich). A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864 ...
-
bioRxiv - Molecular Biology 2021Quote: J1 mES cells with doxycycline-inducible short hairpin RNA-micro RNA (shRNA – Supplementary Table 2) sequences targeting Tet1 or Tet3 were treated for 48h with 2 μg/mL doxycycline (D9891, Sigma Aldrich).
-
bioRxiv - Cancer Biology 2019Quote: ... the PDCD4 shRNA oligonucleotides (5‘-CTGGACAGGTGTATGATGTGG-3’) were synthesised and cloned into the MISSION® TRC2 pLKO.5-puro Empty Vector (SHC201, Sigma) by TsingKe Ltd ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (33-35) and selected with 2 µg/mL puromycin (Sigma-Aldrich). To vary glucose concentration ...
-
bioRxiv - Cancer Biology 2020Quote: Using the custom barcodes lentiviral shRNA library, PDX lines (PATC69, PATC124, PATC53 and PATC153) were transduced in vitro using 8 μg/mL Polybrene (Sigma-Aldrich). Libraries were transduced at 1000X coverage and multiplicity of infection (MOI ...
-
bioRxiv - Neuroscience 2021Quote: ... Cell lines stably expressing shRNA to human FBXO7 were generated as described previously (20) and selected with 2 μg/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral plasmids containing shRNAs targeting STING (shSTING-1 #TRCN0000161345, shSTING-2 #TRCN0000163029) or non-targeted (scrambled) shRNA (shNT #SHC016-1EA) were purchased from Sigma Aldrich. STING-IRES-GFP and DN-IRES-GFP lentiviral plasmids were generated by inserting the cDNA of STING or STING-DN ...
-
bioRxiv - Microbiology 2019Quote: Lentiviral particles carrying an anti-CTIF shRNA were produced in HEK293 cells by transfecting a commercially available pLKO.1 vector containing the shRNA sequence targeting the 3’-UTR of the CTIF mRNA (Sigma-Aldrich), pVSVg and psPax2 ...
-
bioRxiv - Cancer Biology 2021Quote: LCN2 stable knockdown clones were generated in SUM149 or MDA-IBC3 cells by using shRNA (shLCN2-1: TRCN0000060289 from Sigma-Aldrich; shLCN2-2 ...
-
bioRxiv - Immunology 2021Quote: ... pLKO.1 empty vector was from Open Biosystems, and pLKO.1 control shRNA (scramble shSCR, SHC002 and non target shNTgt, SHC016) from Sigma-Aldrich. Lentiviral vectors carrying these constructs were produced by calcium phosphate transfection of 293FT cells with shRNA constructs in combination with packaging vectors psPAX2 ...
-
bioRxiv - Cell Biology 2020Quote: ... TRCN0000073737 5’-CCGGCGCGTTATCAACTGGATCCAACTCGAGTTGGATCCAGTTGATAACGCGTTTTTG-3’ designed and cloned into the lentiviral pLKO.1 puromycin resistant vector Mission shRNA lentiviral Transduction particle (Sigma Aldrich). Control Caco2 clones (shNT ...
-
bioRxiv - Cell Biology 2021Quote: Mission plasmids directing expression of shRNAs targeting PlexinA2 (TRCN0000061499 (ShPlexA2#1) and TRCN0000061501 (ShPlexA2#2)) or PlexinA4 (TRCN0000078683) were purchased from Sigma Aldrich. The production of the lentiviruses ...
-
bioRxiv - Developmental Biology 2022Quote: 300k SV-HUC-1 cells were seeded and transfected with 3µg MISSON pLKO.1-puro non-mammalian targeting control shRNA (Sigma, Cat# SHC002) or shExoc5 (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Scrambled and GAN KO cell lines were generated by transducing SH-SY5Y cells with lentivirus expressing the Mission pLKO.1 backbone for scrambled shRNA (Sigma, #SHC002) and GAN shRNA (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered lentiviral supernatant was introduced to MRC5 cells for FLAG-Raf1 experiments or HFF cells for shRNA experiments in the presence of 5 μg/ml Polybrene (Millipore Sigma). Three hours later ...
-
bioRxiv - Neuroscience 2023Quote: ... commercially available lentiviral small hairpin RNA (shRNA) vectors based on the pLKO.1 backbone (s. Key Resource Table; annotated as “transfected”) were purchased from Sigma-Aldrich. To reduce the amount of DNA needed for transfection to perform pHluorin assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the corresponding empty vector (Genecopoeia. MDK silencing was performed by lentiviral-driven expression of shRNAs, with pLKO-constructs purchased from Sigma Aldrich as previously reported16,17,65 ...
-
bioRxiv - Neuroscience 2024Quote: SH-SY5Y cells with doxycycline-inducible TDP-43 shRNA expression were treated with 5 μg/mL actinomycin D (Sigma-Aldrich, A1410) for 0 ...
-
bioRxiv - Immunology 2023Quote: ... A lentiviral vector expressing shRNA against MDA5 to knock down MDA5 expression in CHME-5xISRE-Nluc (see below) was purchased from Sigma (TRCN0000232948). Lentiviral particles were generated by co-transfection of HEK293T cells with lentivectors (pDuet 5xISRE-Nluc ...
-
bioRxiv - Cancer Biology 2023Quote: ... HNT-34 and OCI-AML3 cells were transduced with shRNA-CD81 or non-targeting (NT) shRNA lentiviral vectors (TRCN0000300291[sh291], TRCN0000300293[sh293], TRCN0000300433[sh433] or TRC2 pLKO.5-puro; Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2023Quote: ... To boost the expression of the shRNA constructs the mice were also provided with 25 mg/kg doxycycline hydrochloride (#D3447, Sigma-Aldrich) resuspended in PBS via intraperitoneal injection once a day for the first two days of doxycycline treatment.
-
bioRxiv - Cancer Biology 2024Quote: ... the cells were infected with the lentivirus expressing shRNA or cDNA in the presence of polybrene (5 μg/mL) (Sigma, USA), followed by selection with puromycin (5 μg/mL ...
-
bioRxiv - Cell Biology 2023Quote: Human EndoC-βH1 and rat INS1E beta cells were cultured as previously described [45] and incubated with lentiviruses expressing an NNAT-targeting shRNA (Sigma-Aldrich) or Silencer Select siRNAs (Ambion) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded in 60 mm dishes at 50-60% confluency and transiently transfected with CEP41 shRNA (5’-GCTTACAGTTACCCAATTGCA-3’, TRCN0000143499, Sigma-Aldrich) or scramble shRNA (SHC002 ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids were isolated (GenElute Plasmid Miniprep Kit, Sigma Aldrich, St. Louis, Missouri, USA) and sequenced with suitable primers (Eurofins Genomics ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid DNA was isolated with a GenElute™ Plasmid Miniprep Kit (Sigma Aldrich) according to the provided protocol.
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was obtained using the GenElute Plasmid Miniprep Kit (Ref. PLN350, Sigma) also including a lysis step with lysozyme (2.5 mg/ml ...
-
Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcription controlbioRxiv - Cell Biology 2019Quote: ... SiRNA constructs with the siRNA cloned in the pLKO.1-Puro vector were obtained from the MISSION shRNA library (Sigma product SHGLY). The specific siRNA sequences used are:
-
bioRxiv - Cancer Biology 2020Quote: ... SASI_Hs01_00221653) and shRNAs targeting TRIM27 (SHCLNG-NM_006510; TRCN0000280319 and TRCN0000011021) or a non-targeting control were purchased from Sigma (St. Louis, MO).
-
bioRxiv - Pathology 2021Quote: HIF-1α protein expression was depleted in human U937 cell line (ATCC, USA) using shRNA targeting HIF-1α (TCRN0000010819, Sigma Aldrich, USA) using a liposome mediated delivery (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Knockdown of EWS-FLI1 in shSK-E17T cells was performed by shRNA induction by addition of 1 μg/ml Doxycycline (Sigma-Aldrich, USA) for 7 days pre-transplantation.
-
bioRxiv - Microbiology 2020Quote: ... Primary human epithelial cells seeded on 10 cm2 dishes were cultured in BEGM medium and transduced with lentiviral particles harboring shRNA against KLK13 (a set of 3) or GFP gene in the presence of polybrene (5 µg/ml; Sigma-Aldrich, Poland). Cells were further cultured for 72 h at 37°C with 5% CO2 and positively transduced cells were selected using puromycin (5 µg/ml Sigma-Aldrich ...