Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for Mouse FAM117A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... we used validated pooled gene specific shRNAs from the RNAi Consortium (TRC) library (Sigma Aldrich, USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... TRCN0000107538-shLBH#3 and TRCN0000107533-shLBH#4) or a non-targeting control shRNA (Sigma, SHC002V) at MOI=5 and in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF to develop PNT2 shERFA1 and PNT2 shERFB1 were obtained from Sigma-Aldrich: TRCN000001391 ...
-
bioRxiv - Immunology 2019Quote: ... IFITM knockdown lines were generated and maintained similarly using lentiviral shRNA constructs purchased from Sigma as described previously (38).
-
bioRxiv - Microbiology 2021Quote: ... EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553). Control cells were transduced an empty vector (pLKO) ...
-
bioRxiv - Cell Biology 2022Quote: Parental Cells or cells expressing the indicated shRNA were labeled with red (PKH 26, Sigma) or green (PKH67 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gene-specific shRNA lentiviral vectors with a pLKO.1 backbone were purchased from Sigma-Aldrich.
-
bioRxiv - Genomics 2022Quote: ... The shRNA expression vectors (with the TRC2 pLKO.5 backbone) were obtained directly from Millipore-Sigma or cloned into the empty backbone using oligonucleotides (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2022Quote: MISSION shRNA retroviral constructs targeting AMOT was purchased from Sigma-Aldrich (Clone ID: NM_133265.1-1628s1c1). To collect viral supernatant ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNA constructs in a pLKO.1 vector targeting human CHMP5 were purchased from Sigma Aldrich along with 2 control non-targeting shRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NM_001569.3-2873s1c1) and a scrambled shRNA were purchased from Sigma Aldrich (St. Louis, Missouri). Lentiviral particles were made using the pLVX Advanced plasmid system (CloneTech Laboratories Inc ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Developmental Biology 2023Quote: ... Rtf1 or NT (non-target) shRNA lentivirus harboring puromycin resistance were purchased from Sigma-Aldrich. mESCs were transduced with the indicated virus at a multiplicity of infection of 1 and selected in 1.2 μg/ml puromycin ...
-
bioRxiv - Genomics 2023Quote: Stable LATS depleted T47D cells were generated by using lentiviral shRNAs obtained from Sigma (MISSION) shRNA Lentiviral Transduction Particles ...
-
bioRxiv - Cancer Biology 2024Quote: Predesigned Cx43 and WNK1 shRNA constructs in pLKO.1-puro were purchased from Sigma-Aldrich. Their respective clone ID numbers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... Downregulation of PAK6 expression was performed utilizing an shRNA against human PAK6 (sh-1944, Sigma). Western blot in SH-SY5Y cell extracts was performed with anti-PAK6 (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA silencing in this study was described previously using the MISSION shRNA Lentiviral Transduction (Sigma-Aldrich)8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stat3 knockdown cell lines were generated by transducing cells with lentiviral shRNA (TRCN0000071456, TRCN0000071454, TRCN0000071453, Sigma). Lentiviruses were generated using 293T cells via transfection with PEI and appropriate vectors ...
-
bioRxiv - Cell Biology 2020Quote: ... lentiviruses as well as desired shRNA viruses in NPC media containing 10 μM Thiazovivin (Millipore, #S1459) and spinfected (centrifuged for 1 hour at 1000g) ...
-
bioRxiv - Cancer Biology 2022Quote: MM cells were transduced with shRNAs or treated with 50nM everolimus (Sellekchem) or 5μM JPH203 (SIGMA) were plated onto a 15 well μ-Slide Angiogenesis ibiTreat chamber slide (Ibidi ...
-
bioRxiv - Cancer Biology 2019Quote: HKII expression was stably interfered by infecting cells with a lentivirus carrying the following shRNAs (Sigma) against mouse HKII mRNA:
-
bioRxiv - Cancer Biology 2020Quote: PLKO.1-puro constructs for knock-down of Tead1 were obtained from Sigma-Aldrich (MISSION shRNAs). Constructs were transfected into LentiX (HEK293T ...
-
bioRxiv - Molecular Biology 2022Quote: The PLK0 lentivirus expressing scramble (SHC002) and UBC9 (NM_003345.3-545S1C1) shRNA expressing vectors were from Sigma. Viral particles were produced and used to transduce HL60 cells as described previously (30) ...
-
bioRxiv - Cancer Biology 2022Quote: ... CGGGACAATGTGTATTACTAT) or non-targeting shRNA (CTL) in the pLKO.1-puro vector (MISSION library, Sigma-Aldrich), and selection with 2 μg/mL puromycin 3-7 days after infection ...
-
bioRxiv - Microbiology 2020Quote: THP-1 were transduced with lentivirus expressing shRNA targeting Rab29 (TRCN0000299449; TRCN0000303685; TRCN0000381042; TRCN0000303621 Sigma-Aldrich) or Rab32 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO.1-puro Vector empty or containing the target shRNA sequence for PIKCδ (Mission Library, Sigma) were transfected using 4-D electroporator (LONZA) ...
-
bioRxiv - Immunology 2019Quote: ... A PLKO.1 vector encoding shRNA for a negative control (Sigma-Aldrich, St. Louis, MO, USA) or a specific target molecule (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... A PLKO.1 vector encoding shRNA for a negative control (Sigma-Aldrich, St. Louis, MO, USA) or a specific target molecule (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... shRNA specific for hERG1b 5’-CCACAACCACCCTGGCTTCAT-3’ and its respective control were purchased from Sigma-Aldrich. For heterologous expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the transcription of shRNAs was induced with 2.0 μg/mL doxycycline hyclate (Sigma-Aldrich, #D9891).
-
bioRxiv - Biochemistry 2024Quote: ... lentivirus was generated by cotransfection of pLKO.1 with shRNA sequences specific to ACSS2 (TRCN0000045563, Millipore), pCMV-dR8.2,and pMD2.G plasmids into HEK293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... the sequence of the shRNA targeting 3UTR of human NRF2 gene was obtained from Sigma Aldrich (TRCN0000007555 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Short hairpin (sh)RNA knockdown constructs were acquired from the Mission TRC shRNA library (Sigma-Aldrich), with target sequences that are shown in supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: MISSION shRNAs against human KIF1A (SHCLNG-NM_004321) and KIF5A (SHCLNG-NM_004984) were obtained from Sigma-Aldrich. Scramble vector was the MISSION pLKO.1-puro non-Mammalian shRNA Control vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The MISSION shRNAs in the pLKO.1 lentiviral vector with a puromycin resistance gene were from Sigma. Product identification numbers for each shRNA are listed – NT-sh ...
-
bioRxiv - Cell Biology 2020Quote: ... A549 cells were infected with PKCε shRNA Mission® lentiviral transduction particles (catalog # SHCLNM_005400) from Sigma-Aldrich according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Nav1.5-shRNA cells and cells non-targeting shControl cells were maintained in G418 (4 μl/ml, Sigma), blasticidin (2 μl/ml ...
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-puro lentiviral vectors expressing shRNAs targeting FASN (shFASN_1: NM_004104.x-1753s1c1 and shFASN_2: NM_004104.x-3120s1c1) were purchased from Sigma-Aldrich. An mCherry-LC3B lentiviral vector was kindly provided by Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... or non-targeting control in the pLKO.1 vector were obtained from the Mission shRNA Library (Sigma).
-
bioRxiv - Cell Biology 2021Quote: NFIC expression was interfered in 266-6 cells using Mission shRNA lentiviral constructs purchased from Sigma-Aldrich. Nfic sh1 [TRCN0000374154 targeting ACAGACAGCCTCCACCTACTT) ...
-
bioRxiv - Cell Biology 2021Quote: ... The AURKA-specific shRNA (SHCLNG-NM_003600) and a non-targeting control (SHC002) were purchased from Sigma-Aldrich. Plasmids and shRNAs were transfected by the calcium phosphate method or with Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... as well as pLKO.1 (50) containing either non-targeting or IFIT1 shRNA (Sigma, TRC1, Clone: TRCN0000158439). Huh7 cells were transduced with the indicated shRNA expressing lentivirus then selected with 2 μg/ml puromycin (Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... All lentiviral vectors (pLKO.1) expressing shRNAs used for knockdown of host proteins were purchased from Sigma.
-
bioRxiv - Genomics 2019Quote: The MISSION pLKO.1-puro human TDP-43 (TRCN0000016038) and control shRNAs (Sigma Aldrich SHC007 and SHC016) were used to produce lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: MISSION TRC shRNA lentiviral library containing 80’000 lentiviral clones targeting 15’000 genes was purchased from Sigma-Aldrich. Cells (3,000 per well ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Molecular Biology 2021Quote: All lentivirus-based shRNA clones used for making the viral transduction particles were purchased from Sigma-Aldrich. pLKO.1-Puro vector targeting human PPARA or non-target vector as a control was used ...
-
bioRxiv - Microbiology 2021Quote: ... ICAM-1kd PLB985 cells were generated by lentiviral transduction with ICAM-1 specific shRNAs from Sigma (TRCN0000372478). EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553) ...
-
bioRxiv - Immunology 2020Quote: ... MISSION shRNA Lentiviral Transduction Particles against human CLPP (TRCN0000291174) or eGFP (RHS4459) were purchased from Sigma-Aldrich and Horizon Discovery respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Expression of either CAPN1 or CAPN2 was knocked down in U251N using shRNA purchased from Sigma-Aldrich (CAPN1 ...