Labshake search
Citations for Millipore Sigma :
651 - 700 of 4287 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Cells were blocked in human blocking buffer (5% human serum (Sigma-Aldrich), 1% rat serum (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... human Akt1 (Sigma-Aldrich) or 0.3 μg active ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified human ApoA1 (Sigma) or purified ApoA1-ApoM protein was resuspended in PBS (10:1 mol/mol ...
-
bioRxiv - Bioengineering 2019Quote: Human holo Tf (Sigma) was conjugated to AF700 or AF750 (Life Technologies ...
-
bioRxiv - Systems Biology 2020Quote: ... human (GluFib, Sigma Aldrich) was added (0.3 ng/µl ...
-
bioRxiv - Neuroscience 2021Quote: ... recombinant human apoE4 (Sigma), and ThT (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Human HDL (Merck Millipore) was incubated with NS1 for 1 hour at 37°C prior to the DSC experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... human fibronectin (Sigma-Aldrich) 5 µg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... human serum (H2918, Sigma), DMXAA (D5817 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human IgG (Sigma), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... human insulin (I9278, Sigma), human TGFβ1 (PHP143B ...
-
bioRxiv - Cell Biology 2022Quote: ... or human fibronectin (Sigma). We found that BSA and collagen IV coating both resulted in reliable cell adhesion ...
-
bioRxiv - Immunology 2022Quote: ... Pooled human serum (Sigma) dilutions and pooled saliva were prepared in a 96-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma), Penicillin-Streptomycin ...
-
bioRxiv - Microbiology 2022Quote: Human fibrinogen (Millipore Sigma) was resuspended in PBS at 1 ng/μL ...
-
bioRxiv - Immunology 2022Quote: ... + 10% human serum (Sigma) + 2mM L-glutamine (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human fibrinogen (Sigma-Aldrich) labeled with fluorescent Alexa Fluor 647 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma) and 50% virus solution in RPMI media (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... Human AB serum (Sigma), recombinant IL-2 ...
-
bioRxiv - Cell Biology 2022Quote: ... with human fibronectin (Sigma) 10 μg/ml for 2h at room temperature under a laminar flow hood ...
-
bioRxiv - Cell Biology 2023Quote: ... human serum (H2918, Sigma), Zymosan (Z4250 ...
-
bioRxiv - Bioengineering 2023Quote: ... human recombinant LIF (Millipore), and Heparin (StemCell Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... human serum (Sigma-Aldrich), trypsin (Promega) ...
-
bioRxiv - Immunology 2023Quote: ... Human interferon-gamma (Sigma) was reconstituted in sterile water and used at 20 ng/ml ...
-
bioRxiv - Bioengineering 2024Quote: ... human laminin (Sigma-Aldrich) and polyethylene glycol diacrylate (PEGDA ...
-
bioRxiv - Cell Biology 2024Quote: ... Human AB serum (Sigma) was used to prepare unstimulated cells or FCS (Biosera or Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were harvested using the GenElute HP plasmid maxiprep kit (Sigma), using 200 ml of culture per plasmid purification column ...
-
bioRxiv - Microbiology 2020Quote: ... plasmid DNA was isolated (GenElute Plasmid Miniprep Kit™, Sigma Aldrich) and further amplified by vector-PCR ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the plasmids were extracted using GenElute Plasmids Miniprep Kit (Sigma-Aldrich) and verified by sequencing ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the plasmids were extracted using GenElute Plasmids Miniprep Kit (Sigma-Aldrich). Each operon constituting the circuits was constructed monocistronically and its sequence was verified before combined into circuits ...
-
bioRxiv - Microbiology 2022Quote: ... plasmids were isolated using a GenElute Plasmid Miniprep Kit (Sigma-Aldrich) and sequenced using standard primers EGFP-C-for (GTCCTGCTGGAGTTCGTG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid minipreps were prepared using GeneElute Plasmid MiniPrep Kit (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant insulin human (≥ 98%), somatostatin-14 (≥ 97%, human HPLC grade), and urocortin-3 (≥ 97%, human HPLC grade) were all purchased from Sigma-Aldrich. Taxonomy will only be indicated for insulin ...
-
bioRxiv - Cancer Biology 2021Quote: ... RD cells were transduced with shRNA control lentivirus particles or shMCU lentivirus particles with polybrene (8μg/ml) (Sigma-Aldrich Inc.). Transduced cells were selected with 1μg/ml puromycin (Sigma-Aldrich Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... To deplete mouse STK3 expression in HMVP2 cells TRC2 MISSION shRNAs in pLKO.1-puro vector backbone were used (Millipore-Sigma). Lentivirus was generated with psPAX2 and pMD2.G packaging plasmids using with the Polyplus jetPRIME transfection kit in 293T cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... Human fibroblasts were doubly transduced with either shRNA or CRISPR vectors in consecutive days in the presence of 8 µg/ml protamine sulfate (Sigma). Transduced cells were selected by puromycin at 1 μg/ml.
-
bioRxiv - Molecular Biology 2021Quote: Stable RNAi-mediated knockdown of TRMT2A was achieved by infection of HEK293T cells with commercially available Lentiviral particles (MISSION® shRNA Lentviral Transduction Particles NM_182984.2-1574s1c1; Sigma-Aldrich). Cells with stable integration of the shRNA construct were determined by a selection of puromycin-resistant colonies (0.5 μg/ml puromycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... The same procedure was used to generate a control cell line (short shK) expressing a scrambled shRNA (SHC002V; Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2021Quote: For stable knock down of PYCR1, shPYCR1 (shPCYR1 #1: CCGGTGAGAAGAA GCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG, shPYCR1 #2: CCGGCACAGTTTCTGC TCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG) and shCTL (Sigma, Mission shRNA) lentivirus was generated in HEK293 cells ...
-
bioRxiv - Cancer Biology 2021Quote: MFSD1kd tumor cells were generated by MISSION lentiviral transduction particles expressing short hairpin RNA (shRNA) from pLKO.1 vector targeting the coding sequence of MFSD1 (Sigma, TRC clone ID TRCN0000338002 and TRCN0000337937 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable cell lines were established using gene specific mission shRNAs (Cat# TRCN0000000595, TRCN0000000592, TRCN0000230910) or non-targeting control (Sigma-Aldrich). Cells were plated at 5×105 in a 6-well dish in growth medium containing 8μg/mL polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The same method was used for virus to be used for GSCs (DMEM was changed to NBM).The shRNA construct number TRCN0000152163 from Sigma human TRC shRNA library was used for knockdown studies of human FMOD ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA and packaging vectors (pMD2.G and psPAX2) were transiently co-transfected into 293T cells by polyethylenimine (Sigma, P3143), and the resulted lentivirus particles were harvested and precipitated by PEG8000 ...
-
bioRxiv - Immunology 2022Quote: Stable knockdown of host proteins in THP1 cells was carried out by transduction with lentivectors expressing individual shRNAs (pLKO.1, 400 ng p24Gag (as measured by ELISA) per 1 × 106 cells) in the presence of polybrene (Millipore). Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml ...
-
bioRxiv - Molecular Biology 2019Quote: ... and expression of shRNAs were monitored under microscope by RFP expression after 96 hours treatment with 2mg/mL Doxycycline (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... were infected with lentiviral pLKO.1-puro vectors expressing specific shRNA sequences for 24 h in the presence of polybrene (8μg/ml; Sigma-Aldrich). After further 24 hrs ...
-
bioRxiv - Genetics 2020Quote: Previously validated shRNA-encoding oligos targeting murine Ubr5 and or a scrambled sequence were cloned into pLKO.1-puro (Sigma). shUBR5 and shScrambled-pLKO.1-puro were co-transfected with pCMV-VSV-G and pCMV-dR8.2 dvpr plasmids into HEK 293T cells using TransIT293 reagent (Mirus Bio LLC ...
-
bioRxiv - Cell Biology 2022Quote: ... two shRNA targeting exon 5 and exon 6 were synthesized along with a control shRNA targeting the luciferase gene as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRor2-1 and shRor2-2 hairpin sequences correspond with shRor2-94 and -98 clones from the MISSION pLKO Lentiviral shRNA libraries (Sigma). Wnt pathway reporters (plasmid 7TGC #24304 ...
-
bioRxiv - Cell Biology 2021Quote: WT and SIRT1 KO mESCs with stable Smpdl3b knockdown were generated by infecting WT and SIRT1 KO mESCs with lentivirus containing vector pLKO.1 or constructs expressing shRNAs against Smpdl3b (B11, B12, and C1) (Sigma). WT and SIRT1 KO mESCs with stable overexpression of SMPDL3B were generated with lentivirus carrying vector Plenti-III-ef1α (Abm ...