Labshake search
Citations for Millipore Sigma :
501 - 550 of 4287 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293 cells were transfected with lentiviruses particles containing Pin1 shRNA (Sigma-Aldrich, TRCN0000010577) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were transfected with Tln1 esiRNA (EMU083531, Sigma Aldrich) or ...
-
bioRxiv - Developmental Biology 2019Quote: Bacterial glycerol stocks for JAG1 and DLL4 MISSION shRNA were purchased from SIGMA. MISSION shRNAs ...
-
bioRxiv - Cell Biology 2019Quote: ... These sequences were selected from The RNAi Consortium (TRC) Mission shRNA library (Sigma) versions 1.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... Rictor-/- MEFs were infected with lentiviral particles encoding an shRNA targeting TBK1 (Sigma) (mouse TBK1 # TRCN0000323444 ...
-
bioRxiv - Cancer Biology 2019Quote: LRP5 & LRP6 shRNA constructs were obtained from the RNAi Consortium database (Sigma Aldrich). Lentivirus was packaged in HEK293T cells (ATCC ...
-
bioRxiv - Genetics 2021Quote: ... five independent DUSP16-targetting shRNA lentiviral vectors from the MISSION® library (Sigma) were transduced in HT-29 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Sfrp1 and Sfrp2 were designed using the MISSION shRNA library from Sigma-Aldrich and ligated using the Rapid DNA ligation kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by knockdown using stable short hairpin interfering RNA (MISSION shRNA, Sigma Aldrich) targeting the 3′UTR of human EZH2 (TRCN0000286227) ...
-
bioRxiv - Cancer Biology 2021Quote: The pLKO.1 shRNA construct targeting MYCN (TRCN0000020694) was purchased from Sigma-Aldrich and the pLKO.1 GFP shRNA was a gift from D ...
-
bioRxiv - Cell Biology 2020Quote: ... a specific short hairpin RNA (shRNA) construct set was obtained from Sigma-Aldrich, and lentivirus production plasmids psPAX2 and pMD2.G were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Individual shRNA and ORF vectors used were from the Mission TRC library (Sigma), and ORF collections were developed by members of the ORFeome Collaboration (Sigma/TransOMIC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... FBP1 (TRCN0000050034, TRCN0000050035) and PP2A-C (TRCN0000002483, TRCN0000002486) shRNAs were purchased from Sigma. SgALDOB was constructed by cloning the guide sequences into the BsmBI site of the lentiCRISPR v2-puro vector ...
-
bioRxiv - Cell Biology 2022Quote: ... Mission shRNA Lentiviral particles designed to target CD95L were purchased: shL3 (Sigma TRCN0000059000), shL1 (Sigma TRCN0000058999) ...
-
bioRxiv - Molecular Biology 2023Quote: ... lentiviruses were produced using vectors from the Mission TRC shRNA library (Sigma-Aldrich) targeting DDB1 (#1 TRCN0000082855 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the pLKO.1-puro-shRNA vectors to target DYRK3 or CAMKV (Sigma Mission clone number available upon request ...
-
bioRxiv - Cancer Biology 2023Quote: Short hairpin RNA sequences targeting FTO or nontarget ‘scrambled’ shRNA control (Sigma-Aldrich) were ordered as forward and reverse oligos ...
-
bioRxiv - Cell Biology 2024Quote: U2OS cells were first knocked down for endogenous BLTP2 using shRNA (Sigma TRCN0000128410) that targets only the 3’UTR of the BLTP2 mRNA ...
-
bioRxiv - Biochemistry 2020Quote: ... adherent human embryonic kidney (HEK) 293T cells were transfected with the expression plasmids with branched polyehtyleneimine (PEI, Sigma-Aldrich). In detail ...
-
bioRxiv - Biochemistry 2022Quote: ... residues 353-598) and human RXRα (NR2B1) LBD (residues 223-462) that were inserted into a pET45b(+) plasmid (Novagen) as a TEV-cleavable N-terminal hexahistidine(6xHis)-tag fusion protein ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mrhl shRNAs (custom synthesised) and non-target control (SHC332) were procured from Sigma-Aldrich. qPCR was performed using BioRad’s CFX96 machine ...
-
bioRxiv - Cancer Biology 2020Quote: ... VCaP cells were cultured for five days following transfection PAT4 shRNA lentivirus (TRCN0000043984; Sigma). Cells were incubated in the isolation media for a period of 24 hours and EVs were purified from the conditioned media via size-exclusion chromatography (SEC).
-
bioRxiv - Cancer Biology 2021Quote: Short hairpin RNAs (shRNA) for target genes and scramble (shCtrl) were purchased from Sigma. pBabe-puro plasmids containing human C/EBPB LAP2 and LIP isoforms were from Addgene (Cat.# 15712 and 15713).
-
bioRxiv - Cancer Biology 2021Quote: ... and A549TP53-/- A3A) were made using the Mission shRNA lentiviral vector NM_020187.1-133s1c1 (Sigma). Lentiviral particles were produced in HEK293T cells using a pLKO.1-shRNA plasmid ...
-
bioRxiv - Physiology 2022Quote: ... pLKO-PCMT1 construct (TRCN0000036403) and Non-Target shRNA Control (SHC016) were from Sigma-Aldrich. Lentiviral pLKO constructs were transfected with packaging and envelope plasmids to HEK293T cells ...
-
bioRxiv - Cell Biology 2022Quote: ... or PTK7-targeting shRNAs from the Sigma MISSION library (Millipore Sigma, Cat# SHCLNG-NM_002821): sh31 ...
-
bioRxiv - Microbiology 2019Quote: ... was used to express short hairpin RNAs (shRNAs) targeted against REAF (Mission TRCN0000141116, Sigma). Additionally ...
-
bioRxiv - Microbiology 2020Quote: Three lentiviral Mission short hairpin RNA (shRNA) clones targeting UBE4B were obtained from Millipore-Sigma ...
-
bioRxiv - Immunology 2022Quote: ... three short hairpin RNAs (shRNAs) against DRAM1 (NM_027878) from the Mission library (Sigma-Aldrich) were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 4EBP1 shRNA lentivirus carrying puromycin resistance was purchased as lentiviral particles (Sigma-Aldrich). The 4EBP2 shRNA was cloned into the pLKO.1_BlastR lentiviral backbone (52) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs expressed by the pKLO.1-puro vector were purchased from Sigma-Aldrich. The sequences for human shDiPRO1 were as follows:
-
bioRxiv - Cancer Biology 2023Quote: Predesigned shRNA in the puromycin-selectable pLKO.1 vector were obtained from Sigma Aldrich, targeting the following sequences – CTNNB1 ...
-
bioRxiv - Cell Biology 2023Quote: ... lentiviral particles harboring shRNA machinery within pSicoR-puromycin vectors were obtained from Sigma-Aldrich (scramble control ...
-
bioRxiv - Cancer Biology 2023Quote: The MISSION lentiviral-based shRNA vector collections from Sigma Aldrich (St. Louis, MO, USA) were used for long-term silencing of BRD4 ...
-
bioRxiv - Neuroscience 2023Quote: ... The shRNA construct for ARID1A (target sequence: TGGACCTCTATCGCCTCTATG, NM_006015) was obtained from Sigma (TRCN0000358749). This pLKO.1-based construct was packaged into lentiviruses ...
-
bioRxiv - Cancer Biology 2023Quote: ... Inducible shRNA expression was activated using 1 µg/mL doxycycline (hyclate D9891, Sigma Aldrich) in the culture medium ...
-
bioRxiv - Biochemistry 2024Quote: ... Induction of shRNA expression was achieved by treating cells with 1µg/ml doxycycline (Sigma) for 72 hours ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A constant amount of plasmid cDNA (15 μg) was transfected into human embryonic kidney cells 293 T (HEK-293T) using polyethylenimine (PEI; Sigma) in a 1:2 weight ratio in 10 cm plates ...
-
bioRxiv - Neuroscience 2023Quote: The pCMV20-Igκ_SP-FLAG vectors used for cloning were constructed by inserting a human Igκ signal peptide (SP) sequence in front of the FLAG tag of the pCMV20 plasmid (Sigma). Full-length (36-713 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: SOX4 short hairpin (sh)RNAs for lentiviral transduction were obtained from Sigma (MISSION shRNA library). We tested six shRNAs and identified the most effective two shRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ... CALCRL MISSION shRNA (shCALCRL#1, Sigma-Aldrich, Cat# TRCN0000356798; shCALCRL#2, Sigma-Aldrich, Cat# TRCN0000356736), E2F1 MISSION shRNA (Sigma-Aldrich ...
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... we used validated pooled gene specific shRNAs from the RNAi Consortium (TRC) library (Sigma Aldrich, USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... TRCN0000107538-shLBH#3 and TRCN0000107533-shLBH#4) or a non-targeting control shRNA (Sigma, SHC002V) at MOI=5 and in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNAs targeting ERF to develop PNT2 shERFA1 and PNT2 shERFB1 were obtained from Sigma-Aldrich: TRCN000001391 ...
-
bioRxiv - Immunology 2019Quote: ... IFITM knockdown lines were generated and maintained similarly using lentiviral shRNA constructs purchased from Sigma as described previously (38).
-
bioRxiv - Microbiology 2021Quote: ... EPCRkd PLB985 cells were generated by lentiviral transduction with EPCR specific shRNAs from Sigma (TRCN0000300553). Control cells were transduced an empty vector (pLKO) ...
-
bioRxiv - Cell Biology 2022Quote: Parental Cells or cells expressing the indicated shRNA were labeled with red (PKH 26, Sigma) or green (PKH67 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gene-specific shRNA lentiviral vectors with a pLKO.1 backbone were purchased from Sigma-Aldrich.
-
bioRxiv - Genomics 2022Quote: ... The shRNA expression vectors (with the TRC2 pLKO.5 backbone) were obtained directly from Millipore-Sigma or cloned into the empty backbone using oligonucleotides (Integrated DNA Technologies) ...