Labshake search
Citations for Millipore Sigma :
6901 - 6950 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Skin was minced into small pieces (about 2-3 mm × 2-3 mm) and digested by incubation with 1 mg/mL collagenase V (Sigma) in PBS for one hour with shaking (250 rpm) ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mm ID × 150 mm, 3-μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate / water ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Microbiology 2024Quote: ... The amine reactive second-generation (AR2G) biosensors were processed with 1-ehtyl-3-(3-dimethylaminopropy) carbodiimide hydrochloride (EDC, E1769, Sigma) and sulfo-N-hydroxysulfosuccinimide (s-NHS ...
-
bioRxiv - Bioengineering 2023Quote: ... d(AA)-3’ and antisense strand: 5’-r(UUU GCC AUG GCA GAA AUA GGC) d(TT)-3’ were purchased from Sigma–Aldrich ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Bioengineering 2023Quote: Liposomal NPs encapsulating MRX-2843 or venetoclax were made by first mixing organic solutions of DSPC (1,2-distearoyl-sn-glycero-3-phosphocoline; NOF Corporation, Shanghai, China), DSPG (1,2-distearoyl-sn-glycero-3-phosphoglycerol, sodium salt; NOF) and cholesterol (Sigma-Aldrich) lipids together at a 7:2:1 mol:mol ratio ...
-
bioRxiv - Plant Biology 2023Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H assay (20mM for pdistal ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... Dried extracts were phase-separated using -20°C LCMS-grade chloroform/methanol/water (1:3:3, v/v) (Sigma Aldrich).
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...
-
bioRxiv - Molecular Biology 2023Quote: ... were cleaned by sonication with 3 M NaOH then Piranha solution (2:3 ratio of 30% (w/w) H2O2 to sulfuric acid) and treated with 3-glycidyloxypropyl trimethoxysilane (GOPTS) (Sigma). GOPTS was then reacted with a mixture of 9 parts α-hydroxy-ω-amino PEG 3000 to 1 part α-biotinyl-ω-amino PEG 3000 by weight (Rapp Polymere) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Bioengineering 2020Quote: ... 0.20 g/L MgCl2·6H2O (Sigma Life Science, St. Louis, MO), and 0.20 g CaCl2·2H2O (Fisher Chemical ...
-
bioRxiv - Microbiology 2020Quote: ... and potassium phthalate monobasic ≥99.5% (20.4 g/L, Sigma-Aldrich, Germany) was added to the media and used as a pH buffer for the experiments ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were immobilized to a poly-L-lysine (Sigma-Aldrich P4707) coated coverslip in a custom flowslide with a parafilm spacer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg/ml rabbit anti-hamster IgG (H+L) (Sigma-Aldrich) added and the median calcium response at 37°C acquired immediately using a BD FACSAria II ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were seeded on poly-L-ornithine (0.1 mg/ml, Sigma) and laminin (1 µg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... and L-buthionine sulfoximine (Cat# B2515) were purchased from Sigma-Aldrich. Buthionine sulfoximine and gemcitabine HCL were dissolved directly into cell media ...
-
bioRxiv - Cancer Biology 2021Quote: The cover slides were treated by 0.01% Poly-L-Lysine (Sigma) for 30min and 10μg/mL Fibronectin (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... and 60 μg/mL L-Ascorbic acid (Sigma, Cat No. A8960) into Advanced DMEM/F12 (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... and seeded in T75 Poly L-Lysine-coated (15μl/ml, Sigma) culture flasks at a density of two brains per flask ...
-
bioRxiv - Cell Biology 2020Quote: ... media was changed to either DMEM without L-glutamine (Sigma D6546) supplemented with 10% FCS and 4 mM [U-13C5]L-glutamine (Cambridge Isotopes CLM-1822) ...
-
bioRxiv - Cell Biology 2020Quote: ... were coated with 0.01% poly-L-ornithine solution (Sigma Aldrich, P4957) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mM of L-glutamine (Sigma-Aldrich, St. Louis, MO) [18] ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM sodium pyruvate and 4 mM L-Glutamine (Sigma-Aldrich)) ...
-
bioRxiv - Cell Biology 2020Quote: SRCa2+ leakage was assessed with 1 mmol/L tetracaine (Sigma-Aldrich) as described by Shannon et al.(32 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were transferred on poly-L-lysine-coated (cat#P8920, Sigma) slides (cat#ER-303B-CE24 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μM T3 (3,3’,5-Triiodo-L-thyronine sodium salt, Sigma), 10 μM ALK5 inhibitor II (Enzo Life Sciences) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM L-glutamine and 20 mM Hepes buffer (Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... a glass was coated with poly-L-lysine (F8920; Sigma Aldrich). Cells in buffer D (30 mM NaCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 M sodium (+)-L-ascorbate (in H2O, as 100x stock, Sigma), 0.5 M Trolox (in DMSO ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injections consisted of L-NAME (Sigma Chemical Co., St. Louis, MO) (a 30 μl injection containing 16.2 μmole of L-NAME in 0.9% saline) ...
-
bioRxiv - Neuroscience 2020Quote: ... 24 well plates were first coated with Poly-L-lysine (Sigma). Around 4×105 cells/well were plated onto 24-well plates containing a mix of ADAM17 variants with eiger fused to AP plasmids and transfection reagent (Fugene) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and rabbit anti-L/M opsin IgG (1:1000, EMD Millipore) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.5 mM L-Glutamine and 1 % Penicillin/Streptomycin (Sigma cat#P0781) in a 37°C incubator with 5 % CO2 to 80-90 % confluency before harvesting.
-
bioRxiv - Molecular Biology 2021Quote: ... and S-(5′-Adenosyl)-L-methionine chloride dihydrochloride (SAM, Sigma 7007) in HMT buffer (50mM Tris ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 160 mg/L tricaine (Sigma-Aldrich, Saint Louis, USA) in order to minimize the artefactual movements ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were cultured in the presence of 210μM L-mimosine (Sigma) or 800nM Aphidicolin (Sigma ...
-
bioRxiv - Physiology 2020Quote: ... corticosterone (25 mg/l, prod. no. 27840; Sigma-Aldrich, Munich, Germany) was added to the drinking saline ...