Labshake search
Citations for Millipore Sigma :
6851 - 6900 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biophysics 2022Quote: 1,2-dioleoyl-sn-glycero-3-phosphocoline (DOPC) (TebuBio) and 1,2-dioleoyl-sn-glycero-3-phospho(1’-rac-glycerol) (sodium salt) (DOPG) (Sigma) were dissolved in chloroform ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 3×106 co-transformants was initially screened for growth on synthetic defined media (SD)-Leu-/ Trp-/ Ura-/ His- media containing 20mM of 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich). Plasmids were isolated from the potential positive colonies ...
-
bioRxiv - Cell Biology 2022Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Immunology 2020Quote: The following reagents were used in this study: 3-methyladenine (3-MA; M9281; Sigma-Aldrich, St. Louis, MO, USA), dimethylsulfoxide (D2650 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...
-
bioRxiv - Cancer Biology 2019Quote: CT26 cells that had been stably transduced with PCK1-targetting shRNA hairpins or control hairpins were grown in vitro for 3 days and counted on day 3 using the Sceptor 2.0 automated Cell counter (Millipore).
-
bioRxiv - Microbiology 2021Quote: ... harvested at day 3 and clarified by centrifugation at 350 x g for 15 minutes (Sigma 3-16K centrifuge). Viral stocks were concentrated by centrifugation at 11 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sigma)10,42 and the metabotropic glutamate receptor antagonist DL-2-Amino-3-phosphonopropionic acid (AP-3) ([1mg/kg] in PBS, stock made in 1M NaOH diluted, pH 7.4; Sigma)10,43 ...
-
bioRxiv - Biophysics 2022Quote: Peak fractions of the PEAK3/14-3-3 complex were pooled and concentrated using an Amicon Ultra-0.5 30k MWCO centrifugal filter (Millipore). Immediately before preparing cryo-EM grids ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm long, 3 µm particle size, Sigma–Aldrich) at a flow rate of 0.25 ml min−1 with a step gradient of mobile phase A (0.1% formic acid ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
bioRxiv - Neuroscience 2024Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm, particle size 3 μm, Sigma-Aldrich) using mobile phase A (0.1% formic acid/water ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Microbiology 2023Quote: ... was subjected to centrifugation through a 3 kDa cut-off membrane filter (Amicon Ultra-0.5 3-kDa Ultracell, Millipore) at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... coverslips were thiol-silanised by submerging for 3 hrs in a 10% solution of (3-Mercaptopropyl)trimethoxysilane (Sigma-Aldrich) in toluene before tempering by incubating at 100°C for 1 hr.
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaves with expressing effectors were immersed in 1 mg/ml DAB (3, 3′-diaminobenzidine) solution (Sigma-Aldrich, USA) at 25°C for 8 h ...
-
bioRxiv - Immunology 2023Quote: ... SRBCs in Alsever’s (TCS Bioscience) were conjugated to recombinant HEL3X (R. Brink) with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma) as previously described104 ...
-
bioRxiv - Cancer Biology 2023Quote: ... blocked in 3 % BSA/PBS and incubated with anti-ZEB1 antibodies (Sigma, HPA027524, 1:200 in 3 % BSA/PBS). After washing and incubation with Alexa594-conjugated secondary antibodies (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Genetics 2024Quote: ... cells were transferred into SFEM II supplemented with 3 U/mL hEPO (SCT) and 3% AB human serum (Sigma) for an additional 5 days of culture ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Genetics 2024Quote: ... Positive interactions were scored by the appearance of white-coloured colonies on a synthetic defined medium containing 6 µg mL-1 adenine and/ or by the growth in the presence of 2 mM 3-Amino-1,2,4-triazole (3-AT) (Cat. No. A8056, Sigma-Aldrich).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Sections were then rinsed with PBS 3 × 10 minutes and blocked with 3% BSA (Bovogen Biologicals, BSAS 1.0) + 0.25% Triton (Sigma Aldrich) in 1x PBS (pH 7.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... R-spondin 3 and Noggin were selected during the 3 first days post seeding by adding 0.5 mg/mL G418 (Sigma-Aldrich) and 0.5 mg/mL Hygromycin B (InvivoGen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Osteogenic differentiation was performed in osteogenic medium (Cyagen, GUXMX-90021) for 3 weeks (medium was changed every 3 days) and quantified by alizarin red staining (Sigma) and qPCR ...
-
bioRxiv - Cell Biology 2019Quote: Cells were washed with PBS then incubated with CSK buffer 3 times for 3 minutes and once for half minute [10 mM Hepes pH 7.0 (Sigma-Aldrich), 100 mM sucrose (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2019Quote: ... Y187 strains were grown on SD/-Trp-Leu medium and transferred to SD/-Trp-Leu-His medium with 10 mM 3-aminotriazole (3-AT, Sigma) in gradient dilutions (1:10 ...
-
bioRxiv - Genetics 2019Quote: ... Aliquots of 1-3 x 109 cells in 150 ml YPD/synthetic medium were fixed in 3% formaldehyde (Sigma, F8775) for 20 min at room temperature and quenched with 25 ml glycine 2.5 M for 20 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain slices containing the ZI slices were first washed (3×3 mins) with 1X Tris-buffered saline (TBS) (Sigma Aldrich) with 0.1% Tween-20 (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... crosslinked to the membrane by chemical treatment at 60°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Sigma) for 1 h 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was transferred to Hybond Nx nylon membranes (Amersham) and crosslinked using EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Sigma) (Pall & Hamilton 2008) ...
-
bioRxiv - Neuroscience 2020Quote: Midbrain or DMS-containing slices were washed (3×3 mins) with 1X Tris-buffered saline (TBS) with 0.1% Tween-20 (Sigma Aldrich), permeabilized (20mins ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then washed with PBS and treated with DAB solution (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 0.06% H2O2) for visualization ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate, Sigma+0.06% H2O2) for color development and visualization ...
-
bioRxiv - Bioengineering 2020Quote: ... and immersed in modified Karnovsky’s fixative (2% w/v glutaraldehyde and 3% w/v PFA in 0.1 M sodium cacodylate buffer containing 5mM CaCl2 and 3% sucrose, all from Sigma-Aldrich) for 1 h at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.5 mmol AuCOOH NPs were added to 200 mL ethanol (80% v/v) containing 1.44 g 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Sigma-Aldrich) and 0.65 g N-hydroxysulfosuccinimide (NHS ...
-
bioRxiv - Neuroscience 2021Quote: ... TAK242 in which mice were subjected to TBI and treated with the TLR4 inhibitor TAK242 diluted in saline containing 3% DMSO (3 mg·kg−1; Sigma-Aldrich). TAK242 or saline were i.p ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Biochemistry 2019Quote: ... Starter cultures were initiated with 1 transformed colony inoculated in a culture tube containing 3 mL LB and 0.1 mg/mL ampicillin (3 μL of 100 mg/mL stock) (Sigma Aldrich) and incubated for ca ...
-
bioRxiv - Cell Biology 2022Quote: ... glass coverslips were etched homogenously with a 0.1 M NaOH solution for 3 min and then treated with 3-(trimethoxysilyl)propyl methacrylate (cat. no. 440159, Sigma-Aldrich) to introduce amine groups to cross-link with the polyacrylamide hydrogel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Fixed embryos were washed with 3%HCl/70%EtOH solution for 3 times and stained in 1% Victoria blue B (Sigma) dissolved in 3%HCl/70%EtOH overnight ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...