Labshake search
Citations for Millipore Sigma :
6851 - 6900 of 10000+ citations for Mouse FAM117A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: The plasmids (EX-T0572-B09, EX-D0356-B09) were transformed in RosettaTM competent cells (EMD Millipore, Burlington, MA, USA) for expression of the light chains ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Template plasmid was digested using DpnI and the PCR products were purified using a PCR purification kit (Sigma-Aldrich). Subsequently ...
-
bioRxiv - Developmental Biology 2019Quote: ... Plasmid DNA was purified with a NucleoBond Xtra Midi kit (Cultech, 22740410.50) and resuspended in nuclease-free water (SIGMA). Other plasmids used were pCMV-GFP expressing GFP under the CMV promoter ...
-
bioRxiv - Microbiology 2021Quote: The Env expression plasmids were used to transfect HEK-293T cells with X-tremeGENE HP DNA Transfection Reagent (Sigma) in combination with either a Tat expression plasmid pTat for Env expression and fusion assays ...
-
bioRxiv - Molecular Biology 2021Quote: The lysates of HEK-293T cells transfected with circPTPN12 plasmid were incubated with Protein-A/G agarose beads (Millipore) and antibody against Ago2 (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... and the reverse primer with in frame Flag sequence 5’GTCTCTCGAGTTACTTGTCATCGTCATCCTTGTAATCTTTCTTTCTGTTGCCTCC3’ and cloned into the pcDNA3 Plasmid (Sigma Aldrich) using the restriction sites HindIII and Xho1.
-
bioRxiv - Biochemistry 2021Quote: ... from the commercially available plasmid 2019-nCoV_N_Positive Control (IDT) and cloned by restriction digest / ligation into MCS-1 of pRSFDuet™-1 (Novagen) to give pSG220 ...
-
bioRxiv - Biophysics 2021Quote: ... The expression and BirA plasmids were mixed at a 9:1 ratio for transfection and 50 μM Biotin (Sigma) was added to the media 4 h post-transfection ...
-
bioRxiv - Neuroscience 2020Quote: Embryos injected with pT2 5UAS hSNRNP70-eGFP and HuC:Gal4 DNA plasmids together with UTP-Cy5 were mounted in 1% low melting point agarose (Sigma) in Danieau’s solution ...
-
bioRxiv - Molecular Biology 2021Quote: Wild-type or mutated pMAL-c2x-malE-L375-his10 plasmids were transformed into Escherichia coli strain BL21 (EMD Millipore) for subsequent growth in LB broth supplemented with 50 μg/ml carbenicillin and 0.2% (w/v ...
-
bioRxiv - Immunology 2020Quote: ... codon-optimized Bl-Eng2 open reading frame with an upstream enterokinase site and downstream c-Myc and 6X histidine tags was cloned into the SpeI and XhoI sites of the pET43.1b plasmid (Novagen); this forms a fusion protein with an upstream NusA tag ...
-
bioRxiv - Biophysics 2021Quote: ... Cells that contained the plasmid were selected based on their expression of a neo gene using geneticin (Sigma-Aldrich). The optimal dose of geneticin for the selection of cells was found to be 800 μg/ml based on a kill curve experiment (range of concentrations tested ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gene encoding Cas7-11 was amplified by PCR and cloned into the modified pACYCDuet-1 plasmid vector (Novagen), expressing Cas7-11 with an N-terminal maltose-binding protein (MBP ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells were co-transfected with lentiviral vector and packaging plasmids (pCMV-dR8.91 and pCMV-VSV-G) using X-treme GENE 9 reagent (Sigma). Culture supernatant containing viral particles was collected 36 and 72 h after transfection and concentrated by centrifugation at 3000g for 60 min at 4℃ ...
-
bioRxiv - Biophysics 2022Quote: ... transformed with the XylE WT gene and cloned in the (30 µg/ml) kanamycin-resistant pET28-a plasmid (Novagen) modified with a C-terminal 10-histidine tag ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl plasmid vectors (2 μg) and/or siRNA oligos (0.1 nmol) containing 0.05% fast green FCF (Sigma-Aldrich) were injected into each DRG ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA plasmids were used at 2 µg/µl and mixed with 1% fast green (Sigma-Aldrich, final concentration 0.2%). Plasmids were injected into the ventricle with a pump-controlled micropipette ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then transfected with the indicated amount of the appropriate plasmid using X-tremeGENE HP reagent (Sigma Millipore) and experiments were performed 24 hours post-transfection.
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then transfected with the indicated amount of the appropriate plasmid using X-tremeGENE HP reagent (Sigma Millipore) and experiments were performed 24 hours post-transfection.
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells were transduced with retroviruses carrying mutant or WT genes in the pLenti6.2-ORF-mClover2-P2A-mRFP plasmid supplemented with 4 μg/ml of polybrene (EMD-Millipore). Cells were selected with 6 μg/ml of blasticidin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... and one ventricle of each embryo was injected with 0.5-1 μL of Endofree plasmid DNA solution mixed with 0.05% Fast Green (Sigma Aldrich) using pulled glass capillaries (Harvard apparatus ...
-
bioRxiv - Genetics 2024Quote: ... gcry1:BFP-3’mitfaHom plasmid was then added to the injection mix along with phenol red (Sigma-Aldrich P0290). The final concentrations injected into the embryos were ...
-
bioRxiv - Biochemistry 2023Quote: Genes encoding VanX (C78/157S mutants with and without W24R) were constructed using the pET-47b plasmid vector (Novagen). The HRV3C recognition sequence and a linker to improve the digestion efficiency were inserted between the (His)6-tag and the vanx sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... RAW264.7 cells were transfected with a CRISPR gRNA plasmid DNA (U6-gRNA:CMV-Cas-9-2A-tGFP) from Sigma-Aldrich, with a specific target sequence for moesin (5’-CCGGCTTCGGATTAACAAG-3’) ...
-
bioRxiv - Molecular Biology 2023Quote: ... We verified candidate plasmids using colony PCR using primers listed in Supplemental Table 2 and REDTaq ReadyMix (Sigma-Aldrich). All plasmids were miniprepped (QIAGEN ...
-
bioRxiv - Biochemistry 2022Quote: ... residues 353-598) and human RXRα (NR2B1) LBD (residues 223-462) that were inserted into a pET45b(+) plasmid (Novagen) as a TEV-cleavable N-terminal hexahistidine(6xHis)-tag fusion protein ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA of this segment was synthesized by Invitrogen and cloned into plasmid pMA-RQ and further subcloned into the bacterial expression vector pET-14b (Novagen/EMD Millipore). The protein was expressed in Bl21 bacteria with the addition of IPTG to a final concentration of 1 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA of this segment was synthesized by Invitrogen and cloned into plasmid pMA-RQ and further subcloned into the bacterial expression vector pET-14b (Novagen/EMD Millipore). The protein was expressed in Bl21 bacteria with the addition of IPTG to a final concentration of 1 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were transfected with 45 ng of plasmid DNA/well using polyethylenimine (PEI) (Sigma-Aldrich, St. Louis, MO, USA) at a 4:1 ratio PEI:DNA in complete media ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 700 ng of plasmid DNA/well using polyethylenimine (PEI) (Sigma-Aldrich, St. Louis, MO, US) at a 4:1 ratio PEI:DNA in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT, Sigma-Aldrich, St. Louis, MO).
-
bioRxiv - Genomics 2023Quote: ... The 800 µl of the plasmid mixture was mixed with 800 µl of HEPES buffered saline (Sigma, 51558-50ML) by making bubbles slowly in a dropwise manner ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were manually scraped off plates to perform a plasmid DNA purification using GenElute Megaprep kit (NA0600-1KT, Sigma).
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmids were incubated in 200 μl Opti-MEN medium mixed with X-tremeGENE HP DNA Transfection Reagent (Sigma) (ratio of reagent ...
-
bioRxiv - Biochemistry 2023Quote: ... were transformed with the pET28 plasmid and induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) (Millipore Sigma) when the optical density at 600 nm reached 0.6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Embryos were injected in lateral ventricle with ∼1 μl of DNA plasmid solution (diluted in endotoxin-free water and 0.002% Fast Green FCF (Sigma)) ...
-
bioRxiv - Biochemistry 2023Quote: 293T cells were seeded into 6-well plates and transfected with replicon plasmid using Xtreme-Gene9 transfection reagent (Sigma). 24 hours post-transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCAG-PiggyBac transposase or PB-pCAG-H2B-GFP (final concentration: 1-2 μg/μL) plasmid was mixed with 0.05% Fast Green (Sigma) and injected into the lateral ventricle of embryos (0.5 μL per embryo ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg viral plasmid were diluted in 6 μL X-tremeGENE 9 DNA transfection reagent (Sigma-Aldrich, 6365787001) and 150 μL DMEM and incubated at room temperature for 15 min before being added to the cells ...
-
bioRxiv - Biochemistry 2024Quote: ... Bacteria containing the corresponding plasmids were grown in LB broth supplemented with 75 µg ml-1 Amp (Sigma-Aldrich) under agitation at 37°C for 24 h ...
-
bioRxiv - Cancer Biology 2021Quote: The C57BL/6 mouse mammary tumor cell line AT3 (Millipore Cat# SCC178, RRID:CVCL_VR89), the mouse melanoma cell line B16F10 (ATCC Cat# CRL-6475 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Secondary antibodies used include HRP-conjugated sheep anti-mouse IgG (Sigma-Aldrich, A5906) and HRP-conjugated goat anti-rabbit IgG (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated in mouse anti-GAD67 primary antibody (1:1000, Millipore MAB5406) in PBS-TX with horse serum for 3 days at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Coverslips were incubated with anti-FLAG mouse primary antibody (1:1000) (Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Biophysics 2020Quote: ... Microtubules were labeled with α-tubulin primary antibody produced in mouse (Sigma, T6074) and a rabbit anti-mouse IgG secondary antibody conjugated to Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... β-actin (A5441) and anti-mouse (AP130P) and anti-rat (AP136P) from SIGMA; GAPDH (ab8245) ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies (mouse anti-MYH3; DSHB F1.652-s, rabbit anti-Laminin; Sigma L9393) were incubated overnight in a cold room followed by washing with PBS-T (0.1% Tween-20 in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies (Rabbit-anti-Catalase, Cell Signaling Technology; Mouse-anti-PMP70, Millipore Sigma; Rabbit-anti-PMP70 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-glutamylated tubulin (B3; 1:200 for IF; Cat#T9822, Sigma), mouse anti-γ-tubulin (GTU88 ...
-
bioRxiv - Cell Biology 2019Quote: Mouse B16-F1 cell line was purchased from Sigma-Aldrich (#92101203, LOT #12F003). Cells were cultured in DMEM (Lonza ...