Labshake search
Citations for Millipore Sigma :
6801 - 6850 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S2 aa 1000 1200 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... DAPI (1:1000 dilution; 5 mg/ml stock solution, Sigma-Aldrich) and Alexa Fluor 488 Phalloidin (1:80 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... conjugated with the AlexaFluor-488 fluorophore (1:1000; Millipore, MAB 377X). Nuclei were also incubated with DAPI (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... 350 µg antigen and 1000 μl Freund’s complete adjuvant (Sigma, F5881) were mixed and injected into the rabbits’ skin ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Asymmetric Di-Methyl Arginine ASYM25 (Sigma, #09-814, 1:1000).
-
bioRxiv - Cell Biology 2023Quote: ... monoclonal mouse acetylated tubulin (clone 6-11B-1, Sigma; 1:1000), polyclonal rabbit alpha tubulin (Abcam ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-c-Myc rabbit antibody clone 7E18 (1:1000, Sigma). Secondary detection was performed using Licor IRDye antibodies IRDye 680-labeled anti-rabbit ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-MARK3 (C-TAK) (1:1000, EMD Millipore, Temecula, CA), rabbit anti-MARK4 (1:1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... rabbit monoclonal anti-HA antibody (Sigma-Aldrich, Cat# H6908, 1:1000), rabbit monoclonal anti-NOTCH3 antibody (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:1000) and DAPI (D9542-1, Sigma, 1:10,000) were incubated for 2hrs at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... PBMCs were thawed with 1:1000 Benzonase:RPMI (Sigma Aldrich Cat. #E8263). The CD14+ population was isolated from the PBMCs using CD14+ ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:1000 benzonase nuclease (250 U/ L) from Sigma-Aldrich] ...
-
bioRxiv - Cell Biology 2023Quote: ... γ-tubulin (Ms GTU-88, Sigma, WB 1:1000, IF 1:500), GAPDH (Ms ...
-
bioRxiv - Neuroscience 2023Quote: ... A mouse antibody to NeuN (MAB377, Millipore, 1:1000 in PBS) was applied overnight at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... Primary antibodies used include Par3 (Millipore Sigma #07-330, 1:1000) and Gapdh (Millipore Sigma #MAB374 ...
-
bioRxiv - Physiology 2024Quote: ... The primary antibodies included rabbit anti-STIM1 (1:1000, HPA012123, Sigma), rabbit anti-ANO1 (1:100 ...
-
bioRxiv - Cell Biology 2024Quote: ... 125 μm beta-mercaptoethanol supplemented with 1000 U/ml LIF (Millipore) and 2i inhibitors ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-mouse monoclonal anti-Tubulin (Sigma-Aldrich, T6199; IB 1:1000); anti-rabbit monoclonal anti-GAPDH (Cell signalling ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-pTyr357-YAP (Sigma, Y4645; IB 1:1000, IF 1:100); anti-p73 (Cell Signaling Technology ...
-
bioRxiv - Genetics 2024Quote: ... incubated with the anti-FLAG antibody 1:1000 (Sigma Aldrich, #F3165), washed in 0.1% PBS-tween ...
-
bioRxiv - Cell Biology 2024Quote: ... counterstained with DAPI (1/1000) and mounted using FluorSave reagent (Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... and guinea pig anti-VGluT2 (1:1000, Sigma cat. #AB2251-I) in a PBS solution containing 0.1% TritonX-100 and 5% NGS overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... or β-actin mouse polyclonal antibody (Sigma-Aldrich, A1978,1:1000 dilution) at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... Slides were stained against phospho-gH2AX (1:1000, #05-636 Millipore) for 1.5hrs in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... nuclear staining was performed using 1:1000 of DAPI (Sigma, D9542) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were incubated with DAPI at 1:1000 (Sigma-Aldrich, D9542) for 5 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... and subsequently stained with Phalloidin-TRITC (1:1000, P1951, Sigma-Aldrich) and Hoechst 33342 (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... total Rab12 (1:1000 Proteintech and β-actin (1:3000, Sigma) at 4C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... and nuclei counterstained with DAPI (SIGMA, dilution 1:1000 in PBS) for approximately 5 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated with DAPI at 1:1000 (Sigma-Aldrich, D9542) for 5 minutes and Prolong Gold Antifade Mountant (Invitrogen #P36934 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was probed with 1/1000 α-HA primary antibody (Sigma H6908) to detect 3xHA_FCU ...
-
bioRxiv - Genetics 2021Quote: ... Anti-His (SCBT, #sc-8036; used in 1:2000), anti-GST (SCBT, #459; used in 1:5000) and anti-Flag (Sigma-Aldrich, #F7425;used in 1:2000). Peroxidase conjugated anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein eluates were separated by SDS PAGE and stained with Coomassie Brilliant Blue or with anti-His antibody after transfer onto a nitrocellulose membrane (Sigma-Aldrich, Steinheim, Germany; dilution 1: 5000).
-
bioRxiv - Cell Biology 2019Quote: ... The proteins of the eluate were separated by SDS PAGE and stained with Coomassie Brilliant Blue or with anti-His antibody after transfer onto nitrocellulose membrane (Sigma-Aldrich, Steinheim, Germany; dilution 1: 5000).
-
bioRxiv - Physiology 2022Quote: ... 2-bromopalmitate (2-BP) was delivered with fatty acid-free bovine serum albumin (Sigma-Aldrich, A6003) at a stock concentration 1 mM albumin with 5 mM 2-BP ...
-
bioRxiv - Cell Biology 2019Quote: ... the cell pellet was resuspended in 2 ml of 2 mg/ml collagenase IA (Sigma Aldrich) in PBS and incubated for 1 h at 37 °C on a horizontal shaker at 100 rpm ...
-
bioRxiv - Physiology 2019Quote: ... Bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES, Sigma Aldrich Cat. No# SML0601) was used at a concentration of 20μM for 1 hour in low (5 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Immunology 2021Quote: ... Materials for interference testing included 2-phenoxyethanol (2-PE) (77699-250ML, Sigma-Aldrich, St Louis, MO), sodium citrate tribasic dihydroxide (C8532-100G ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 pmol (2 µL of stock) of the non-labelled AQUA® peptide HLEAAKGYSFTTTAEKAAELHK (Sigma-Aldrich) containing the quantification tag sequence GYSFTTTAEK was added to enable quantification of SIL-protein stock concentrations using MS analysis based on the ratio of heavy-to-light GYSFTTTAEK signals (see below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected approximately 2 μL of DNA (2 μg/μL) mixed with 0.1% Fast Green (Sigma) in PBS into a lateral ventricle of the embryonic brain with a pulled glass micropipette ...
-
bioRxiv - Plant Biology 2019Quote: ... resuspended in 2 ml of BY-2 medium supplemented with 150 µM acetosyringone (D134406, Sigma-Aldrich) and incubated at 28°C ...
-
bioRxiv - Neuroscience 2020Quote: ... were performed with MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in Sanz et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5-chloro-2′-deoxyuridine (CldU) and 5-Iodo-2′-deoxyuridine (IdU) were obtained from Sigma-Aldrich. Click-iT EdU Alexa Fluor 488 Imaging Kit was obtained from Invitrogen ...
-
bioRxiv - Biophysics 2019Quote: HUVECs were purchased from Lonza and cultured in Endothelial Cell Basal Medium (EBM-2) supplemented with 2% fetal calf serum (Sigma) and the following growth factors ...
-
bioRxiv - Biochemistry 2019Quote: ... resuspended at 2 × 107 / ml and incubated with 2 µg / ml anti BrdU antibodies (Sigma B8434) for 2 hrs at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... HDI crosslinker (#52649) and 2-(trifluoromethyl)phenyl isocyanate (2-TPI) (#159379) were purchased from Sigma Aldrich. N,N-dimethylformamide (DMF ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 2 dpf in egg water with 0.003% 1-Phenyl-2-thiourea (PTU; Sigma, Cat#P7629) to suppress pigmentation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein sample (400 μg) was reduced by adding 2 μl of Tris(2-carboxyethyl)phosphine (Sigma) and incubating samples at 60 °C for 1 h ...