Labshake search
Citations for Millipore Sigma :
6551 - 6600 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and finally in BABB solution (benzyl alcohol + benzyl benzoate 1:2, v/v, Sigma, 24122 and W213802) until optical transparency.
-
bioRxiv - Cancer Biology 2023Quote: ... and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA, SHC002, Sigma-Aldrich).
-
bioRxiv - Bioengineering 2023Quote: ... polyethylene oxide polymers (Mw: 1 MDa, Mw: 2 MDa, and Mw: 5 MDa, Sigma-Aldrich, Buchs, Switzerland) were fully dissolved in PBS to a concentration of 1% (w/v) ...
-
bioRxiv - Cell Biology 2023Quote: ... and fertilized eggs were cultured in EmbryoMax KSOM Medium (1X) w/ 1/2 Amino Acids (Merck Millipore) at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: A sample of polysaccharide 33X (1-2 mg) was dissolved in deuterium oxide (D2O) (Sigma-Aldrich, USA), subjected to centrifugation for 5 min at 16800 x g ...
-
bioRxiv - Bioengineering 2023Quote: ... and rinsed with 1×PBS before blocking and permeabilizing with 2% bovine serum albumin (BSA, Sigma-Aldrich) in 0.2% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA, E3889, Sigma-Aldrich), 0.1 mM ATP (BP413-25 ...
-
bioRxiv - Biophysics 2024Quote: ... These mice were sacrificed 2 days after tamoxifen injection and perfused with 1% paraformaldehyde (PFA) (Sigma-Aldrich) in phosphate-buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained with DAPI 2 mg/ml in distilled water (Sigma-Aldrich, Ref D9542, 1:3000) for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... were homogenized (2% w/v) in 1× IP buffer (10X IP Buffer, Cat. No. I5779, Sigma-aldrich.com) supplemented with protease and phosphatase inhibitors (protease inhibitor tablet ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell pellets were resuspended in 2% HI-FBS PBS with 1 µg/mL DAPI (Sigma Aldrich, #D9542) to stain dead cells ...
-
bioRxiv - Physiology 2024Quote: ... for 1 hour followed by incubation with Hoechst (2 µmol/L, Cat. # 94403; Sigma-Aldrich, Darmstadt, Germany) for 10 minutes at room temperature ...
-
bioRxiv - Physiology 2024Quote: ... with 1 µg/mL 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride protease inhibitor (AEBSF; SBR00015, Sigma-Aldrich, Inc.;). Total cell lysate protein concentrations were determined with the Better Bradford Kit (23236 ...
-
bioRxiv - Microbiology 2024Quote: ... 111-035-144) for 2 hours or 1:10,000 anti-β-actin conjugated to HRP (Sigma A3854) for 1 hour ...
-
bioRxiv - Physiology 2024Quote: ... Samples were then diluted 1:2 once more in trehalase digestion (Trehalase from porcine kidney, Sigma T8778), or trehalose buffer for control ...
-
bioRxiv - Microbiology 2024Quote: ... and subsequently replica plated onto SC -URA 2% ethanol medium containing 1 μM spermidine (Sigma-Aldrich, S2626) and 0.01 μg/mL ATI-2307 ...
-
bioRxiv - Cell Biology 2024Quote: Cells were plated 2 days before imaging in medium containing 1 µM Cdk4/6i (PD-0332991, Sigma). Twenty-four hours later ...
-
bioRxiv - Cell Biology 2020Quote: ... R-spondin 3 and Noggin were selected during the 3 first days post seeding by adding 0.5 mg/mL G418 (Sigma-Aldrich) and 0.5 mg/mL Hygromycin B (InvivoGen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Osteogenic differentiation was performed in osteogenic medium (Cyagen, GUXMX-90021) for 3 weeks (medium was changed every 3 days) and quantified by alizarin red staining (Sigma) and qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain slices containing the ZI slices were first washed (3×3 mins) with 1X Tris-buffered saline (TBS) (Sigma Aldrich) with 0.1% Tween-20 (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: Midbrain or DMS-containing slices were washed (3×3 mins) with 1X Tris-buffered saline (TBS) with 0.1% Tween-20 (Sigma Aldrich), permeabilized (20mins ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then washed with PBS and treated with DAB solution (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 0.06% H2O2) for visualization ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate, Sigma+0.06% H2O2) for color development and visualization ...
-
bioRxiv - Bioengineering 2020Quote: ... and immersed in modified Karnovsky’s fixative (2% w/v glutaraldehyde and 3% w/v PFA in 0.1 M sodium cacodylate buffer containing 5mM CaCl2 and 3% sucrose, all from Sigma-Aldrich) for 1 h at RT ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Cell Biology 2022Quote: ... glass coverslips were etched homogenously with a 0.1 M NaOH solution for 3 min and then treated with 3-(trimethoxysilyl)propyl methacrylate (cat. no. 440159, Sigma-Aldrich) to introduce amine groups to cross-link with the polyacrylamide hydrogel ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mm ID × 150 mm, 3-μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate / water ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Bioengineering 2023Quote: Liposomal NPs encapsulating MRX-2843 or venetoclax were made by first mixing organic solutions of DSPC (1,2-distearoyl-sn-glycero-3-phosphocoline; NOF Corporation, Shanghai, China), DSPG (1,2-distearoyl-sn-glycero-3-phosphoglycerol, sodium salt; NOF) and cholesterol (Sigma-Aldrich) lipids together at a 7:2:1 mol:mol ratio ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Plant Biology 2023Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H assay (20mM for pdistal ...
-
bioRxiv - Bioengineering 2023Quote: ... d(AA)-3’ and antisense strand: 5’-r(UUU GCC AUG GCA GAA AUA GGC) d(TT)-3’ were purchased from Sigma–Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Plant Biology 2024Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H screen/ assay ...
-
bioRxiv - Cell Biology 2024Quote: 4-week-old TRE-Arhgef11/Krt14-rtTA mice (3 males and 3 females) were IP-injected with 25 mg/kg doxycycline (Sigma) 10 hours before sacrifice and tissue collection.
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... the supernatants described above were diluted 10-fold with 0.1% formic acid and separated on a Discovery HS-F5-3 column (150 × 2.1 mm, 3 μm particle size; Sigma- Aldrich) with mobile phases consisting of solvent A (0.1% formic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...