Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for 6H Pyrrolo 3 2 e benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium) reagent and paraformaldehyde were purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... 0,005 CPP [()-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid] (NMDA receptors antagonist, Sigma Aldrich). Traces of whole-cell voltage-clamp recordings (holding potential ...
-
bioRxiv - Microbiology 2023Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-(4,5 dimethylthiazol-2-tl)-2,3-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (STL, USA). Bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Cancer Biology 2024Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Bioengineering 2024Quote: ... Phalloidin and MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Sigma Aldrich. DMEM (Dulbecco’s Modified Eagle’s Medium) ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 0.5 mg/mL 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) for 4 hrs at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... hormones were maintained in the culture medium throughout the course of each assay. 17-ß-estradiol (i. e., E2) and progesterone (i. e., P4) (both from Sigma; St. Louis, MO) were selected for use in infection studies because these hormones represent the major forms of estrogens and of progestogens (respectively ...
-
bioRxiv - Physiology 2021Quote: ... The sections were further stained with hematoxylin and eosin (H&E) that was conducted on 10% formalin-fixed muscle section with Mayer’s H&E (Sigma Chemical, St. Louis, MO, USA). Immunofluorescence (IHC ...
-
bioRxiv - Pathology 2020Quote: Ela-Cre AT-1fl/+ and Ela-Cre AT-1fl/fl mice at 2-3 months of age were treated with tamoxifen (MP Biomedicals, 3mg/40g BW dissolved in 98% corn oil [Sigma] and 2% ethanol [Sigma]) by oral gavage once daily for three days to induce Cre recombinase activity ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Cell Biology 2019Quote: ... Rotenone and Williams E Media from Sigma-Aldrich (Dorset, UK). Ammonium chloride ...
-
bioRxiv - Developmental Biology 2021Quote: ... Oocytes and embryos were incubated in 0.5% pronase E (Sigma) for 3-5 minutes to remove zona pellucida ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections were stained with hematoxylin and eosin (H&E) (Sigma). Antigen retrieval was performed with citrate buffer pH6 ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on poly-D-lysine (PDL, A003-E, Millipore) coated 10 cm dishes ...
-
bioRxiv - Plant Biology 2021Quote: ... (1990) with 0.8% (w/v) agar (Type E, Sigma- Aldrich). When required ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg/mL of Pronase E protease mixture (Sigma–Aldrich) was gently added directly and allowed to incubate at 37 °C (2 h) ...
-
bioRxiv - Cell Biology 2022Quote: ... Isolated HFs were maintained in Williams E media (Sigma-Aldrich) supplemented with 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2020Quote: ... Parasites were sedimented on poly-lysine (A-003-E, SIGMA) coverslips (150µL/coverslip ...
-
bioRxiv - Cancer Biology 2022Quote: ... and stained with haematoxylin and eosin (H&E; Merck + Sigma) or IHC using antibodies of interest ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated with mouse anti-E-cadherin (Millipore, MAB1199) at 1:200 dilution in blocking solution at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... transferred to the Immobilon-P/E PVDF membrane (Merck Millipore), and immunodetected using the SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: ... followed by additional infiltration with 20 μM E-64d (Sigma) for an 8 h period ...
-
bioRxiv - Neuroscience 2020Quote: ... Pronase E (Protease from Streptomyces griseus Type XIV, Sigma Aldrich) was diluted in water to a concentration of 2 mg/mL ...
-
bioRxiv - Neuroscience 2020Quote: E-4031 (Alomone-Labs, IL) and TEA (Sigma-Aldrich, USA) were dissolved in 0.9% saline ...
-
Neuraminidase inhibitors rewire neutrophil function in vivo in murine sepsis and ex vivo in COVID-19bioRxiv - Immunology 2022Quote: ... LPS (1 µg/mL, E. coli 0127:b8, Sigma-Aldrich), LPS plus Oseltamivir or LPS plus Zanamivir ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were stained with hematoxylin and eosin (H&E, Sigma) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to Immobilon-E PVDF Transfer membrane (Sigma, IEVH85R). Blocked the membrane with 5% skimmed milk and incubated with primary antibody i.e. ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 U Pyrophosphatase (E. coli, MFCD00131379 from Sigma-Aldrich®), 0.127 mg.ml−1 MtATPS ...
-
bioRxiv - Neuroscience 2022Quote: ... or lipopolysaccharide (LPS, Sigma-Aldrich, E. coli, O111:B4, L4391) dissolved in PBS at a dose of 5 mg/kg (cohort 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit polyclonal anti-α E-catenin (C2081) was from Sigma. Rabbit polyclonal anti-phospho-Myosin Light Chain 2 (Thr18/Ser19 ...
-
bioRxiv - Neuroscience 2023Quote: ... hNPCs were treated with 100 nM compound E (EMD Millipore) in Neural Medium for 48 hours and then maintained in Neural Medium supplemented with 20 ng/ml each of hBDNF and hGDNF for 3 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... Following resuspension in 50 ml/tube of E-MEM (Sigma), large cell aggregates were eliminated by filtering the cell suspension with a 60-μm stainless cell strainer (Ikemoto Scientific Technology) ...
-
bioRxiv - Biochemistry 2023Quote: ... William’s E Medium and hydrocortisone were purchased from Sigma Aldrich. Human insulin was purchased from pharmacy (Humulin N ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-human E-cadherin (EMD Millipore, DECMA-1) at a concentration of 1/200 in a humidified incubator overnight ...
-
bioRxiv - Bioengineering 2024Quote: Channel blockers E-4031 and nifedipine were purchased from Sigma, aliquoted in DMSO at a concentration of 10 mM ...
-
bioRxiv - Pathology 2024Quote: ... a 1% aqueous solution of eosin Y (Sigma E-6003) was prepared in deionized water and Harris Hematoxylin stain (Lerner Laboratories 1931382 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barium – gelatin mix (E-Z-EM Canada Inc; Sigma-Aldrich) was perfused until consistent pressure matching RVSP was obtained ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... D-Asp3-E-Dhb7-RR was purchased from Sigma Aldrich. Anabaenopeptin A and B ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Microbiology 2019Quote: Primers used in this study (Table 2) were designed with Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) and synthesized by Sigma-Aldrich.
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Cell Biology 2019Quote: Cell viability was assessed with 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, #M5655, Sigma Aldrich) after treatment with MMC and the PARP inhibitor Olaparib (AZD2281 ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Biochemistry 2021Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, MO) as described previously.52 Equivalent MTT assays were performed on cells cultured in the same ratios of PBS to media ...
-
bioRxiv - Microbiology 2021Quote: ... sporozoites were added to 1 ml molten 3% agarose (2-Hydroxyethyl agarose – Sigma-Aldrich, dissolved in ddH2O), centrifuged and incubated at 4°C for 5 min ...