Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 6H Pyrrolo 3 2 e benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... coated with poly-D-lysine (Sigma; A-003-E) at a density of 0.25×106 cells/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... with 0.25% % fetal bovin e serum (FBS, Sigma-Aldrich). Cells were then directly fixed for 20 min at RT with 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 20 ng/mL rEGF (Sigma Aldrich, E-9644) was added into each well ...
-
bioRxiv - Genetics 2022Quote: ... a γ-secretase inhibitor Compound E (0.2µM, EMD Millipore) was added to the cells to inhibit cell division ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-E-cadherin (Cdh1) (1:300 dilution, Sigma). Secondary antibodies against sheep ...
-
bioRxiv - Cell Biology 2021Quote: ... stained with hematoxylin and eosin (H&E; Sigma-Aldrich), or stained with PAS reagent ...
-
bioRxiv - Systems Biology 2021Quote: ... 20 ng/ml Epidermal Growth Factor (Sigma, #E-9644), 100 ng/ml cholera toxin (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... or the e-cigarette vehicle (propylene glycol; Sigma-Aldrich) daily from GD 5-20 during a 40-min vapor inhalation session (2 L/min airflow ...
-
bioRxiv - Immunology 2020Quote: Alexa fluor 488 labelled bacteria (E. coli, Sigma-Aldrich) and yeast (S ...
-
bioRxiv - Immunology 2021Quote: ... and/or 2.5 μg/ml E-cadherin-Fc (Sigma). IELs were plated in RPMI-T medium containing 2 μg/ml PerCP-e710 conjugated anti-CD107a (1D4B ...
-
bioRxiv - Immunology 2021Quote: ... LPS (E. coli serotype O55:B5, Sigma, 10ng/ml), CpG ODN 1826 (TIB MOLBIOL ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Complete hepatocyte seeding medium contains Williams’ Medium E (Sigma) with final concentrations of 1% Pen/Strep (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 μM Purmorphamine and 0.1 μM Compound E (Millipore) for 6 days to mature into CHAT+ motor neurons.
-
bioRxiv - Cell Biology 2022Quote: ATDC5 cells (Sigma-Aldrich #99072806 supplied by E-ACC) were cultured in DMEM/F12 (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... or 100 ng/mL LPS (E. coli:B4, Sigma-Aldrich). Choline-free DMEM was formulated by preparing nutrient-deficient DMEM (US Biologicals ...
-
bioRxiv - Neuroscience 2023Quote: LPS (E. coli, O111:B4 serotype, Sigma Aldrich, UK) was dissolved at 0.5 mg/ml in sterile 0.9% saline ...
-
bioRxiv - Cancer Biology 2023Quote: ... monoclonal rat anti-E-cadherin (1:300, Sigma-Aldrich), mouse anti-p120-catenin (1:400 ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ethylene glycol tetratacetic acid (EGTA; Sigma E-3889) treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... For hematoxylin and eosin (H&E) staining (Sigma-Aldrich), standard procedures were followed ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... H&E staining was performed using Hematoxylin (Sigma-Aldrich) and Eosin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 17-β-estradiol (E2) (Cat# E-060, Sigma Aldrich) was used in all assays at a physiologic concentration of 1 nM/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... the culture medium was HFH: Williams’ Media E (Sigma) supplemented with nicotinamide (12 mM) ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich, France) at −80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 were obtained from Sigma-Aldrich (St. Louis, MO, USA). The secondary fluorescent antibody Alexa Fluor 488 (goat anti-mouse ...
-
bioRxiv - Molecular Biology 2022Quote: The 3-(4,5-dimethylthiazol-2-ul)-2,5-diphenyl tetrasodium bromide (MTT, Sigma-Aldrich, St. Louis, MO) cytotoxicity assay measures mitochondrial reductases ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2022Quote: ... Selection was initiated after 2-3 days with 25-150μg/ml of Hygromycin B (Sigma-Aldrich) and maintained for 10-15 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated for 3 hours in 100 μl of 2% acrylamide (AA; A4058, Sigma-Aldrich) + 1.4% formaldehyde (FA ...
-
bioRxiv - Microbiology 2023Quote: ... and tissues digested in 3 mL complete HBSS-2 containing 0.5 mg/mL Collagenase-D (Sigma) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... and 2-heptyl-3-hydroxy-4-quinolone (PQS) were obtained from Sigma Aldrich (St. Louis, MO). Triton X-100 and Tween-20 were used at 0.2% and 2% ...
-
bioRxiv - Cancer Biology 2023Quote: Cellular proliferation was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT; Sigma) assay and validated by viable cell counts.80
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability was assessed using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Sigma-Aldrich). 10μl MTT (5 mg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Bioengineering 2022Quote: ... USA) and subsequently submerged in a solution of 2% bis[3-(trimethoxysilyl)propyl]amine (Sigma-Aldrich), and 1% DI-water in IPA at 80°C for 20 minutes following previously published protocols 67 ...